-
No products found
because this supplier's products are not listed.
Adam Lauko, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 2 μg/ml acridine orange (Sigma A6014) was added for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Bhairavi Tolani, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Proton transport was measured using ATP-dependent quenching of 9-amino-6-chloro-2-methoxy-acridine (Acridine Orange, ThermoFisher) fluorescence quenching for isolated vacuoles as previously described21
-
No products found
because this supplier's products are not listed.
Tommaso Villa, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3 mM MgCl2 and 2 μL (10 u) RNase H (NEB) in order to digest poly(A ...
-
No products found
because this supplier's products are not listed.
Junya Yokoyama, et al.,
bioRxiv - Cell Biology 2021
Quote:
... anti-heparan sulfate proteoglycan 2 (1:100; Abcam), anti-desmin (1:100 ...
-
No products found
because this supplier's products are not listed.
Jean-Loup Faulon, Paul Ahavi, Thi-Ngoc-An Hoang,
bioRxiv - Synthetic Biology 2024
Quote:
... magnesium sulfate : 2 mM MgSO4 (Merck/Sigma-Aldrich, CAS number : 7488-88-9), (iii ...
-
No products found
because this supplier's products are not listed.
Irene Julca, et al.,
bioRxiv - Plant Biology 2022
Quote:
... The medium was aspirated and fresh medium containing 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, premixed in 5:1 ratio, Promega) was added to the treated cells ...
-
No products found
because this supplier's products are not listed.
James M. Gahan, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... was diluted 10-fold with ChIP incubation buffer (70 mM NaCl, 10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 2 mM EDTA, 0.1% Triton, 1 x Roche Complete EDTA-free Protease inhibitor cocktail) ...
-
No products found
because this supplier's products are not listed.
Mehmet E. Karasu, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... A cell count ranging from 1 × 10^5 to 2 × 10^5 cells was collected and suspended in 15 µL of nucleofection buffer (Lonza). Electroporations were conducted in the strip format ...
-
No products found
because this supplier's products are not listed.
Fushun Wang, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 6-Isopropoxy-9-xanthone-2-carboxylic acid (AH6809, 10 µM, Tocris); N-(piperidin-1-yl)-5-(4-iodophenyl)-1-(2,4-dichlorophenyl)-4-methyl-1H-pyrazole-3-carboxamide (AM251 ...
-
No products found
because this supplier's products are not listed.
Kai-En Chen, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 50 μl of 10 mg/ml stock of 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) and 1-palmitoyl-2-oleoyl phosphatidylethanolamine (POPE) in a 9:1 ratio (Avanti Polar Lipids) was freshly prepared in a 500 μl volume and lipid films formed using the same method as Folch liposomes ...
-
No products found
because this supplier's products are not listed.
Asifa Islam, et al.,
bioRxiv - Cell Biology 2022
Quote:
... SKA3 (Santa Cruz; H-9; 1:500) and CREST antisera (Europa ...
-
No products found
because this supplier's products are not listed.
Shene Chiou, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 5% v/v 2-mercaptoethanol) and fractionated by 4-15% Tris-Glycine gel (Bio-Rad Cat#5678084) using Tris-Glycine running buffer (0.2M Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Kyla D Omilusik, et al.,
bioRxiv - Immunology 2021
Quote:
... Id2 (1:1000; 9-2-8, CalBioeagents or D39E8, Cell Signaling), Id3 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Arne Knörck, et al.,
bioRxiv - Immunology 2021
Quote:
... To this end 1×104 targets per well and 2×104 effector cells per well were each preincubated for 2 h in 10 μg/ml anti-human CD178 antibodies (NOK-1 and NOK-2, BD Biosciences) or 5 μg/ml anti-human TRAIL antibody (RIK-2 ...
-
No products found
because this supplier's products are not listed.
Erik Ames Burlingame, et al.,
bioRxiv - Systems Biology 2020
Quote:
... pH 9 (Agilent, S236784-2) for 15 minutes ...
-
No products found
because this supplier's products are not listed.
Hannah Elcocks, et al.,
bioRxiv - Cell Biology 2023
Quote:
... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
No products found
because this supplier's products are not listed.
A. Lamaa, et al.,
bioRxiv - Pathology 2023
Quote:
... rehydrated and antigen unmasking was realized with pH 9 Tris solution (H-3301, Vector Laboratories) 5 min three times in a microwave ...
-
No products found
because this supplier's products are not listed.
Kim Doyon-Laliberté, et al.,
bioRxiv - Immunology 2022
Quote:
... CD4+ T-cells were cultured alone or co-cultured with either of the B-cell populations at a ratio of 3:1 for 60 h at 37°C and 5% CO2 on anti-CD3 (2 μg/mL) (ULTRA-LEAF Biolegend) coated flat bottomed 384 CellCarrier Ultra microplates (PerkinElmer ...
-
No products found
because this supplier's products are not listed.
Andrea J. Manrique-Rincón, et al.,
bioRxiv - Immunology 2024
Quote:
... Every 48 hours the cells were centrifuged and the pellet was resuspended between 1 and 2 × 106 per mL in fresh complete media containing the OVA peptide 3 μg/mL and IL-2 (100 U/mL) after the second stimulation IL-15 (10 ng/mL, Peprotech) was added The number of stimulations is indicated in the figure/text ...
-
No products found
because this supplier's products are not listed.
Katherine R. Ferrick, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 10 μM 5-ethynyl-2’-deoxyuridine (EdU, Cayman Chemical Cat#20518, CAS# 61135-33-9). For drug treatments and time courses ...
-
No products found
because this supplier's products are not listed.
Alief Moulana, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... Transformants were plated on SDCAA-agar (1.71 g/L YNB without amino acids and ammonium sulfate [Sigma-Aldrich #Y1251], 5 g/L ammonium sulfate [Sigma-Aldrich #A4418], 2% dextrose [VWR #90000–904] ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Addgene)[70] in a ratio of 5:3:2 using polyethylenimine (24765-2, Polysciences). Virus supernatant was harvested 30 h after transfection ...
-
No products found
because this supplier's products are not listed.
Valencia L. Potter, et al.,
bioRxiv - Cell Biology 2020
Quote:
Eye cups from mice aged 4-8 months (Figures 2–5) or 10 days postnatal (Figures 6, 7, 9) were fixed for five minutes in 1% PFA (Electron Microscopy Science) diluted in 1x PBS ...
-
No products found
because this supplier's products are not listed.
Gopinath Kulasekaran, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... supplemented with 2 µg/ml heparin sulfate (STEMCELL Technologies) or SFM supplemented with 20 ng/ml human recombinant epidermal growth factor (hEGF ...
-
No products found
because this supplier's products are not listed.
Francesca Finetti, et al.,
bioRxiv - Immunology 2020
Quote:
... Postnuclear supernatants (2 mg/sample) were immunoprecipitated for 2 h using 2 μg of rabbit anti-IFT20 antibody (#13615-1-AP, Proteintech), anti-ATG16L1 antibody (#8089S ...
-
No products found
because this supplier's products are not listed.
Isaline Guex, et al.,
bioRxiv - Microbiology 2023
Quote:
... an aliquot of 50 μL of bacterial culture was mixed with 2 mL sterile saline (9 g NaCl L-1) solution in a 5 mL polystyrene tube (Falcon, Corning, NY, USA). The following parameter settings were used for cell quantification ...
-
No products found
because this supplier's products are not listed.
Päivi Ylä-Anttila, Maria G. Masucci,
bioRxiv - Cell Biology 2021
Quote:
... For co-immunoprecipitation of endogenous SQSTM1/p62 the cell lysates were incubated for 2-4 h with specific antibody followed by 1-2 h with protein-G coupled Sepharose beads (GE Healthcare, 17-0885-01). To resolve protein complexes for denaturing immunoprecipitation ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Raghu Pandurangi, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and heparin sulfate (2 μg/mL; R&D Systems). BTSC lines were confirmed to match their parental primary GBM tumor tissue by short tandem repeat profiling (Calgary Laboratory Services and Department of Pathology and Laboratory Medicine ...
-
No products found
because this supplier's products are not listed.
V. Nieddu, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Antigen was unmasked with Tris-EDTA pH 9 (Bond Epitop Retrival Solution 2 Leica, cat# AR9640). Both mouse monoclonal anti-Ki67 CloneMIB-1 (Dako ...
-
No products found
because this supplier's products are not listed.
Golam T. Saffi, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 20 μCi/ml myo-[2-3-H(N)] inositol (PerkinElmer, MA) and indicated treatment conditions ...
-
No products found
because this supplier's products are not listed.
Avital Licht-Murava, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Sections were blocked for 2 h in 10% normal donkey serum (Jackson ImmunoResearch) and 2% non-fat dry milk and incubated overnight on a rocking platform with primary antibodies in 3% normal donkey serum ...
-
No products found
because this supplier's products are not listed.
Bar Maron, Jonathan Friedman, Zvi Hayouka,
bioRxiv - Evolutionary Biology 2022
Quote:
... Optical density (OD595) was measured every 15 min through 24 h using Epoch 2 microplate reader (BioTek). Lag time ...
-
No products found
because this supplier's products are not listed.
Sunniyat Rahman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
No products found
because this supplier's products are not listed.
Christiane Linster, et al.,
bioRxiv - Neuroscience 2020
Quote:
12 (Experiment 2) and 9 (Experiment 3) adult male C57Bl6/J mice (Charles River Laboratories) aged 2 months at the beginning of the experiments were used for pharmacological experiments ...
-
No products found
because this supplier's products are not listed.
Binh An Nguyen, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... we further purified the extracts by treatment with 1% sodium dodecyl sulfate in NaP-EDTA buffer and centrifugation at 13,000 rpm for 10 min (rotor FA-24×2, Eppendorf). This purification process was repeated two times ...
-
No products found
because this supplier's products are not listed.
Macarena Fernández-Chacón, et al.,
bioRxiv - Physiology 2023
Quote:
... This step was followed by 6 washes with 1% Triton X-100 in PBS for 15 min and incubation for 2 h with conjugated secondary antibodies (1:200, Jackson Laboratories) and DAPI in PBS at room temperature ...
-
No products found
because this supplier's products are not listed.
Marie R Brunchault, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 50 mM Tris-HCl pH 7.4) and ultracentrifuged at 250 000 x g for 2 h (Beckman Optima TL 100 Ultracentrifuge). After ultracentrifugation ...
-
No products found
because this supplier's products are not listed.
Kylie M. Konrath, et al.,
bioRxiv - Immunology 2021
Quote:
... The splenocytes were stimulated for 20 hours at 37°C with RBD peptides (15-mer peptides overlapping by 9 amino acid spanning the RBD of SARS-CoV-2 spike protein, GenScript), at 5μg/mL of each peptide in RPMI + 10% FBS (R10) ...
-
No products found
because this supplier's products are not listed.
Athanasios Dimitriadis, et al.,
bioRxiv - Neuroscience 2022
Quote:
... the resulting solution was incubated with 3 volumes of TRI-reagent at room temperature for 2 hours (R2050-1-50; Zymo Research). The mix was then transferred out of the BSL-3 facilities and nucleic acids were purified using the Direct-zol DNA/RNA miniprep kit (R2080 ...
-
No products found
because this supplier's products are not listed.
Katerina Stepankova, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and anti-VGLUT1/2 (Synaptic Systems, #1235503, 1:800, 3 days). Goat anti-host antibodies of the respective primary antibodies conjugated with Alexa Fluor 405 ...
-
No products found
because this supplier's products are not listed.
Camila de Britto Pará de Aragão, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Data acquisition (filtered at 2–3 kHz and digitized at 15 kHz; Digidata 1440A, Molecular Devices, CA, USA) was performed using the Axopatch 200B amplifier and the Clampex 10.6 software (Molecular Devices) ...
-
No products found
because this supplier's products are not listed.
RE Jefferson, et al.,
bioRxiv - Biophysics 2023
Quote:
... antibodies in T cell media (RPMI 10 % FBS, 2 mM L-Glutamine, 1 % Penicillin-Streptomycin) with IL-15 and IL-7 (Miltenyi Biotec, 10 ng/ml each ...
-
Leibovitz L-15 media powder, a component of the NCIS kit. Reconstitute entire contents of...
Cat# LK003250,
1 ea, $33.00
Ask
Luke R. Perreault, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Minced tissue underwent 3-5 serial digestions in collagenase type 2 (Worthington Biochemical Corp, Lakewood, NJ) in sterile PBS with 20 mM glucose ...
-
No products found
because this supplier's products are not listed.
Kazuki Moroishi, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Confocal images of MiaPaCa-2 cells incubated for 3 h and 24 h were taken using a confocal laser scanning microscope (FV3000, Olympus, Tokyo, Japan). MiaPaCa-2 incubated for 3 and 24 h were washed 3 times with phenol red-free DMEM adjusted at pH= 7.4 and 6.5 ...
-
No products found
because this supplier's products are not listed.
David Kim, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... MMP-2/-9 (Novus Biologicals), C3 (Abcam) ...
-
No products found
because this supplier's products are not listed.
Michihito Sasaki, et al.,
bioRxiv - Microbiology 2022
Quote:
Calu-3 cells were inoculated with SARS-CoV-2 Delta variant at an MOI of 3 for 2 h in M), camostat (50 μM, Wako) or anti-SARS-CoV-2 spike (1 μg/ml, GTX635792, GeneTex)] ...
-
No products found
because this supplier's products are not listed.
Matthew S.J. Mangan, et al.,
bioRxiv - Immunology 2021
Quote:
... Rac1/2/3 (1:1000, rabbit polyclonal #2465) from CST, actin (mouse or rabbit, both 1:1,000 dilution) from LI-COR Biosciences ...