-
No products found
because this supplier's products are not listed.
Johannes Rheinlaender, et al.,
bioRxiv - Biophysics 2020
Quote:
... For the PEG coating a 20kDa PEG polymer with NH2 and COOH groups on either end was used (NH2-PEG20K-COOH, Sigma-Aldrich, Germany). The NH2 side of the PEG polymer was bound to the beads by first activating the carboxyl groups exposed on the surface of the beads via ECD/NHS ...
-
No products found
because this supplier's products are not listed.
Alena Casella, et al.,
bioRxiv - Bioengineering 2023
Quote:
... the aqueous phase consisted of 10 kDa 8-arm PEG-vinyl sulfone (PEG-VS) (JenKem, Plano, TX) and RGD (Ac-RGDSPGERCG-NH2, Genscript, Piscataway, NJ) in 100 mM HEPES buffer (N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid ...
-
No products found
because this supplier's products are not listed.
Pantong Yao, et al.,
bioRxiv - Neuroscience 2023
Quote:
0.2 μm Red Carboxylate-Modified Microspheres (Invitrogen, F8810 ...
-
No products found
because this supplier's products are not listed.
Talita Stelling de Araújo, et al.,
bioRxiv - Biophysics 2020
Quote:
... 20 % PEG 3350 (Hampton Research PEG Ion I solution 30, “PEG ion I30”)
-
No products found
because this supplier's products are not listed.
Hiroki Fukunaga, et al.,
bioRxiv - Biophysics 2023
Quote:
... Amine-modified DNA oligonucleotides (NH2/GTGATGTAGGTGGTAGAGGAA) were linked to the benzylguanine (BG; NEB), and BG-oligonuculeotides were labeled with myosin II containing a C-terminal SNAP-tag (NEB ...
-
No products found
because this supplier's products are not listed.
Wander Van Breedam, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 5-kDa and 10-kDa linear PEG polymers (MeO-(CH2CH2O)n-NH2) were obtained from JenKem Technology (Custom Synthesis), 20-kDa PEG linear (CH3O-(CH2CH2O)n-CONH-CH2-O-NH2 ...
-
No products found
because this supplier's products are not listed.
Ana M. Villamil Giraldo, et al.,
bioRxiv - Biophysics 2022
Quote:
... PLL-PEG and PLL-PEG-biotin were purchased from SuSoS AG ...
-
No products found
because this supplier's products are not listed.
Thomas Fryer, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... or 40 mM chloroalkane-PEG-NH2 (Promega P6741) with one volume of 40 mM methacrylate-NHS (Sigma 730300 ...
-
No products found
because this supplier's products are not listed.
Jonas Wilhelm, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 25% PEG 8000 from the PEG suite screen (Qiagen) after 48 hours at 18°C ...
-
No products found
because this supplier's products are not listed.
Akihiro Matsumoto, et al.,
bioRxiv - Neuroscience 2024
Quote:
... the retina was illuminated by dim red light (KL 1600 LED, Olympus) filtered with a 650 ± 45 nm band-pass optical filter (ET650/45× ...
-
No products found
because this supplier's products are not listed.
Xinhui Xu, et al.,
bioRxiv - Biochemistry 2020
Quote:
An amino-modified oligo RE-NH2 (Table S3) was covalently coupled to the DNA-BIND 96-well microplate (Corning) according to the instructions of manufacturer to prepare the oligo-coated microplate ...
-
No products found
because this supplier's products are not listed.
Paul O’Callaghan, et al.,
bioRxiv - Cell Biology 2020
Quote:
... PAR2 agonist peptide SLIGRL-NH2 (Abcam, Cambridge, UK) was diluted to 1 mM in OptiMEM RSM and stored at −20 ° C ...
-
No products found
because this supplier's products are not listed.
Leonardo Lupori, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Red light illumination was provided by 8 individually addressable LEDs (WS2812) attached to the objective (Leica Z6 APO coupled with a Leica PlanApo 2.0X 10447178 ...
-
No products found
because this supplier's products are not listed.
Julya Sorokina, et al.,
bioRxiv - Microbiology 2021
Quote:
... pET28a-c (cloning with NH2-terminal 6His tag, Merck), and pMal-c5x (cloning with the NH2-terminal maltose-binding protein (MBP ...
-
No products found
because this supplier's products are not listed.
Keach Murakami, Hiroki Ikawa,
bioRxiv - Plant Biology 2022
Quote:
We measured the light response curves of flag leaves and third leaves from the top of the plant using blue and red light-emitting diodes light sources at a photosynthetic photon flux density (PPFD) ratio of 1:9 (6400-40; LI-COR Inc.). Measurements were performed two to three times per week from early June (heading stage ...
-
No products found
because this supplier's products are not listed.
Pablo Domizi, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... PEG-it solution (System Biosciences Innovation) was added to the viral supernatant ...
-
No products found
because this supplier's products are not listed.
Joseph de Rutte, et al.,
bioRxiv - Bioengineering 2021
Quote:
... The PEG phase was crosslinked with focused UV light through a DAPI filter set and microscope objective (Nikon, Eclipse Ti-S) near the outlet region of the microfluidic device ...
-
No products found
because this supplier's products are not listed.
Delphine Autheman, et al.,
bioRxiv - Microbiology 2021
Quote:
... 108 splenocytes were fused to 107 SP2/0 myeloma in 50 % PEG (PEG 1500, Roche, Hertfordshire, UK), using standard procedures ...
-
No products found
because this supplier's products are not listed.
Christoph Schmitz, et al.,
bioRxiv - Bioengineering 2024
Quote:
... consisting of a modified light microscope (Axioskop; Carl Zeiss Microscopy, Jena, Germany) with Plan-Neofluar objectives 1.25× (numerical aperture [NA] = 0.03) ...
-
No products found
because this supplier's products are not listed.
Iris Seitz, et al.,
bioRxiv - Bioengineering 2024
Quote:
... red light (A647 channel) using a ChemiDoc MP system (Bio-Rad).
-
No products found
because this supplier's products are not listed.
Adjélé Wilson, et al.,
bioRxiv - Biophysics 2022
Quote:
... was further subjected to size exclusion chromatography under dim red light (HiLoad 16/600 Superdex 75 pg, GE Healthcare). The protein eluted as a unique peak in 50 mM Tris-HCl buffer pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Chu Chen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Emission light in the red channel was filtered by an ET632/60m (Chroma Technology). Emission light in the green channel was filtered by an ET525/50m (Chroma Technology) ...
-
No products found
because this supplier's products are not listed.
Floor A.A. Ruiter, et al.,
bioRxiv - Bioengineering 2021
Quote:
Agilent PEG calibration kit (PEG molecular weights up to 300,000 MW, Agilent Technologies) were used for calibration ...
-
No products found
because this supplier's products are not listed.
Ana S Almeida, et al.,
bioRxiv - Microbiology 2021
Quote:
... Zombie Red (BioLegend) was used to differentiate between dead and live cells ...
-
No products found
because this supplier's products are not listed.
Kuo-Sheng Lee, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The cranial window was illuminated with a collimated red light LED (635 nm peak, ACULED VHL, part. no. E001947, Perkin Elmer) and imaged with a CCD camera at 10 fps with 256 × 332 pixel resolution (Retiga-2000R ...
-
No products found
because this supplier's products are not listed.
Brijesh Kumar, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... PZP KTB40 and KTB42 cells were modified to express Tomato Red or GFP markers using pCDH-EF1-Luc2-P2A-tdTomato (#72486, Addgene) or pCDH-EF1-Luc2-P2A-Cop GFP (#72485 ...
-
No products found
because this supplier's products are not listed.
Weisheng Wang, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Light flashes (0.2 mW/mm2) from a blue LED light source (Sutter Instruments) were delivered via the microscope optics and a 40x water immersion objective lens and controlled remotely using TTL pulses from Clampex ...
-
No products found
because this supplier's products are not listed.
Qamar Taban, et al.,
bioRxiv - Immunology 2022
Quote:
... The secondary antibodies used were Anti-rabbit IgG (H+L) (DyLight™ 800 4X PEG Conjugate) #5151 and Anti-mouse IgG (H+L) (DyLight™ 800 4X PEG Conjugate) #5257 (Cell Signaling Technology) respectively ...
-
No products found
because this supplier's products are not listed.
Yuhuan Li, et al.,
bioRxiv - Genetics 2020
Quote:
Liver lipid accumulation was confirmed by Modified Oil Red O stain kit (Solarbio, G1261) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jared Feldman, et al.,
bioRxiv - Immunology 2021
Quote:
... and kappa light chain (PE anti-human kappa light chain; BD Biosciences) double positivity using a SH800S Cell Sorter (Sony Biotechnology) ...
-
No products found
because this supplier's products are not listed.
Yuta Ishizuka, et al.,
bioRxiv - Neuroscience 2022
Quote:
... light chain specific (Jackson ImmunoResearch Labs ...
-
No products found
because this supplier's products are not listed.
Priscilla Ambrosi, Talia N. Lerner,
bioRxiv - Neuroscience 2021
Quote:
... Red retrobeads (LumaFluor) were diluted 1:4 (dilution factor ...
-
No products found
because this supplier's products are not listed.
Erika Beyrent, et al.,
bioRxiv - Cell Biology 2024
Quote:
... the coverslips were PEGylated by incubating in a 1:100 mixture of 1% biotin-PEG-silane in ethanol (Laysan Bio Biotin-PEG-SIL-2K-1g) and PEG-silane (85%, VWR 77035-498) for one hour in the dark at room temperature ...
-
No products found
because this supplier's products are not listed.
M. Swanson, et al.,
bioRxiv - Physiology 2024
Quote:
Sirius red staining was performed on the kidney sections using a modified protocol from Polysciences. In brief ...
-
No products found
because this supplier's products are not listed.
Indra Van Zundert, et al.,
bioRxiv - Bioengineering 2024
Quote:
... NHS ester-(PEG)4-DBCO (Vector Labs, USA), Cyanine3 NHS ester (Lumiprobe ...
-
No products found
because this supplier's products are not listed.
Alex Shepherd, et al.,
bioRxiv - Immunology 2022
Quote:
... All target cell lines described in this paper were modified using Nuclight-Red Lentiviral reagent (Cat#4625, Sartorius, USA) to generate stable red-fluorescent cells which can be easily differentiated from effector cells in FACS or live microscopy analyses ...
-
No products found
because this supplier's products are not listed.
Grishma Rane, et al.,
bioRxiv - Immunology 2023
Quote:
... 1x MyTaq Red Reaction buffer red and 0.5 μl of MyTaq DNA polymerase (Bioline) on SimpliAmp thermal cycler (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Sung Hoon Lee, et al.,
bioRxiv - Systems Biology 2020
Quote:
... the collected supernatants were mixed in PEG solution (final concentration 0.1 g/ml PEG 6000, NaCl 0.3M in deionized water, autoclaved) and stored at 4 °C overnight more than 12 hours ...
-
No products found
because this supplier's products are not listed.
Soh Ishiguro, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... we concentrated harvested virus samples using a polyethylene glycol (PEG)-based method (65) using PEG 6000 (Wako #169-09125) or Lenti-X Concentrator (Takara #631231). When PEG 6000 was used ...
-
No products found
because this supplier's products are not listed.
Šimon Borna, et al.,
bioRxiv - Immunology 2022
Quote:
... Phenol Red (Lonza), supplemented with 5% human serum (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Stylianos Kosmidis, et al.,
bioRxiv - Cell Biology 2021
Quote:
Brain samples were imaged using a light sheet fluorescence microscope (UltraMicroscope II Light Sheet Microscope, Miltenyi Biotec, Germany) equipped with an sCMOS camera (Andor Neo) ...
-
No products found
because this supplier's products are not listed.
Himabindu Vasuki Kilambi, et al.,
bioRxiv - Plant Biology 2020
Quote:
Chloroplast movement in tomato leaf was monitored by the measurement of red light transmittance through leaf discs at 25°C using a microplate reader (Biotek, Synergy HT) as described by Wada and Kong (2011) ...
-
No products found
because this supplier's products are not listed.
Nagalakshmi Balasubramanian, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Animals were housed in a ventilated and temperature-controlled vivarium on a standard 12-hour cycle (lights on at 0230) with ad libitum access to food (Envigo NIH-31 Modified Open Formula 7913) and water.
-
No products found
because this supplier's products are not listed.
Akhilesh Nandan, et al.,
bioRxiv - Biophysics 2021
Quote:
... was dissolved in Dulbecco’s modified Eagle’s medium (with 25 mM HEPES, without Phenol Red) (PAN Biotech). Imaging media ...
-
No products found
because this supplier's products are not listed.
Jeffrey Downey, et al.,
bioRxiv - Immunology 2021
Quote:
... and NucSpot Far-Red (Biotium), according to the manufacturer’s instructions and unfixed cells were acquired immediately by flow cytometry.
-
No products found
because this supplier's products are not listed.
Joshua M. Boyte, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Luciferase luminescence was imaged from the following morning in continuous light (40 µmol m-2 red and blue LED; LB3, Photek) using a Retiga LUMO CCD camera (Teledyne Photometrics). Circadian rhythms were analysed using FFT-NLLS in Biodare (Zielinski et al. ...
-
No products found
because this supplier's products are not listed.
Christopher J. Presloid, et al.,
bioRxiv - Biochemistry 2024
Quote:
... RED-tris-NTA dye (NanoTemper), and 0.05% Tween 20 in CPD and incubated for 30 min at 20°C ...
-
No products found
because this supplier's products are not listed.
Adi Miriam Goldenberg, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Light pulses were triggered by pClamp software (Molecular Devices, 20ms duration ...
-
No products found
because this supplier's products are not listed.
Amy V. Paschall, Zahra Nawaz, Fikri Y Avci,
bioRxiv - Immunology 2024
Quote:
... and Ghost Red 710 (Tonbo Biosciences). For intracellular staining ...
-
No products found
because this supplier's products are not listed.
Zechuan Shi, et al.,
bioRxiv - Neuroscience 2024
Quote:
... CM2: BrainPhys neuronal medium without Phenol-Red (STEMCELL Technologies); B27 supplement ...