-
No products found
because this supplier's products are not listed.
Shathiyah Kulandavelu, et al.,
bioRxiv - Physiology 2021
Quote:
... and dihydrorhodamine 123 (DHR 123, 25 mM; Sigma-Aldrich), respectively ...
-
No products found
because this supplier's products are not listed.
Allison K. Scherer, et al.,
bioRxiv - Immunology 2022
Quote:
... Dihydrorhodamine-123 (DHR-123, Life Technologies, Eugene, OR) was added to each condition at a final concentration of 1 μM ...
-
No products found
because this supplier's products are not listed.
Julia L. Meng, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 647-HRP (Jackson ImmunoResearch 123-605-021). ...
-
No products found
because this supplier's products are not listed.
Lei Peng, et al.,
bioRxiv - Immunology 2021
Quote:
... and pFUSE2ss-CLIg-hK (InvivoGen, pfuse2ss-hclk), respectively ...
-
No products found
because this supplier's products are not listed.
AM Schonhoff, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Ly6C (clone HK 1.4, BioLegend), CD38 (clone 90 ...
-
No products found
because this supplier's products are not listed.
Christophe Huret, et al.,
bioRxiv - Immunology 2024
Quote:
... CD4-APC (130-123-207, Miltenyi Biotec), CD5-APC-Vio770 (130-120-165 ...
-
No products found
because this supplier's products are not listed.
Robin Alexander Rothemann, et al.,
bioRxiv - Biochemistry 2024
Quote:
The activity assay was carried out by coupling the AK2 reaction to hexokinase (HK) and glucose-6-phosphate dehydrogenase (G6PDH, HK/G6PDH mix from Roche). In this assay ...
-
No products found
because this supplier's products are not listed.
Anthony L. Gaeta, et al.,
bioRxiv - Genetics 2022
Quote:
Rhodamine 123 plates were made by first dissolving rhodamine 123 (VWR Cat. No. 89139-378) in dimethyl sulfoxide (DMSO ...
-
No products found
because this supplier's products are not listed.
Goodluck Benjamin, et al.,
bioRxiv - Plant Biology 2024
Quote:
... and Total starch HK assay kit (Megazyme K-TSHK), respectively ...
-
No products found
because this supplier's products are not listed.
M Iqbal Hossain, et al.,
bioRxiv - Neuroscience 2023
Quote:
... anti–HK-1 (Cell Signaling) and anti-GFP (Cell Signaling ...
-
No products found
because this supplier's products are not listed.
Rebecca E. Wagner, et al.,
bioRxiv - Cell Biology 2024
Quote:
... HK were cultured in basal medium (Promocell) or KGM-gold (Lonza) ...
-
No products found
because this supplier's products are not listed.
Malgorzata Wygrecka, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Germany) or rabbit-anti high molecular weight kininogen (HK; cat. no.: ab35105; Abcam, Cambridge, UK) antibody ...
-
No products found
because this supplier's products are not listed.
Preeti Sharma, et al.,
bioRxiv - Immunology 2021
Quote:
... Dihydrorhodamine (DHR) 123 (Merck). After the incubation of cells with particles for 2 and 18 hours ...
-
No products found
because this supplier's products are not listed.
Karuna Mittal, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... TP53 (Santa Cruz; sc-123), TRIP13 (Abcam ...
-
No products found
because this supplier's products are not listed.
Vanessa M. Doulames, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Stem123 (AB-123-U-050, 1:1000 dilution; Takara Bio Inc.), TBR1 (ab183032 ...
-
No products found
because this supplier's products are not listed.
Philip J. Medeiros, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... HIF-1α (Novus Biological, NB100-123), HIF-2α (Novus Biological ...
-
No products found
because this supplier's products are not listed.
Miranda F. Koloski, et al.,
bioRxiv - Neuroscience 2023
Quote:
Male Long-Evans rats (Charles River, Wilmington MA, N = 123) were received at approximately one month old weighing 150g (UCSD ...
-
No products found
because this supplier's products are not listed.
Semira R. Ortiz, et al.,
bioRxiv - Biochemistry 2022
Quote:
... HK-2 cells were obtained from ATCC (CRL-2190) and cultured in Dulbecco’s Modified Eagle Medium (DMEM) (Corning) with 1% penicillin/streptomycin and 10% FBS (Cytiva).
-
No products found
because this supplier's products are not listed.
Elodie C. Leroy, et al.,
bioRxiv - Molecular Biology 2023
Quote:
In vitro translation was carried out with a custom PURExpress ΔRF-123 ΔRibosome kit (New England Biolabs), using ∼5 pmol of 5’-biotinylated and 3’-polyadenylated mRNA as a template ...
-
No products found
because this supplier's products are not listed.
Francesca Pischedda, et al.,
bioRxiv - Neuroscience 2020
Quote:
NSF (123 002-Synaptic System); alpha-Synuclein (D37A6-Cell Signaling) ...
-
No products found
because this supplier's products are not listed.
Annalisa Tito, et al.,
bioRxiv - Microbiology 2020
Quote:
Human Kidney-2 cells (HK-2) were obtained from American Type Culture Collection (ATCC) and were cultured in Dulbecco’s Modified Eagle Medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Stefan Andreas Zambach, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and BQ-123 (Cat. No. 1188, Tocris) were directly dissolved in aCSF ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... CAATGCCTGCTACATGGAGGA (CS-HSH1530L-LVRU6GP-01, for Human HKs, GeneCopoeia). Lentivirus was packed using the Dharmacon Trans-Lentiviral ORF Packaging Kit with Calcium Phosphate (TLP5916) ...
-
No products found
because this supplier's products are not listed.
Sallieu Jalloh, et al.,
bioRxiv - Microbiology 2024
Quote:
... or goat anti-human DyLight 800 (Rockland, #609-145-123) for 1-3 hours at RT ...
-
No products found
because this supplier's products are not listed.
Nicole Pogodalla, et al.,
bioRxiv - Neuroscience 2021
Quote:
... anti-HRP-Alexa Flour 647 conjugated (Cat# 123-005-021, Dianova); anti-Nazgul was a gift from B ...
-
No products found
because this supplier's products are not listed.
Rita Reig-Viader, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Supernatants were transferred to 0.5 ml tubes (#0030 123 301; Eppendorf) previously washed with ACN to prevent peptide binding to the walls ...
-
No products found
because this supplier's products are not listed.
Yulia Kiyan, et al.,
bioRxiv - Cell Biology 2020
Quote:
... HK-2 cells were nucleofected using Mirus nucleofection solution and T20 program of nucleofector (Lonza).
-
No products found
because this supplier's products are not listed.
Marie-Claude Gaudreau, et al.,
bioRxiv - Immunology 2021
Quote:
... IGRP(123-145) were custom synthesized (GenScript Inc) and used in this study ...
-
No products found
because this supplier's products are not listed.
Qianqian Liu, Zengyuan Tian, Yuqi Guo,
bioRxiv - Plant Biology 2021
Quote:
The hexokinase (HK) activity assay kit (BC0740) purchased from Solarbio was used to detect the content of hexokinase with WT ...
-
No products found
because this supplier's products are not listed.
Alexandria P. Lassetter, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Alexa Fluor® 647 anti-HRP (Goat anti-HRP, Jackson Labs #123-605-021), anti-oaz (Rabbit anti-oaz ...
-
No products found
because this supplier's products are not listed.
Kristina V. Dylla, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Flies were mostly raised on Nutri-Fly® Molasses Formulation (# 66-123, Genesee Scientific) supplemented with sucrose (1.6% ...
-
No products found
because this supplier's products are not listed.
Luciana Lazar-Stefanita, et al.,
bioRxiv - Genetics 2023
Quote:
... yLS118-123) were prepared in agar molds using the Certified Megabase Agarose (Bio-Rad, 1613108), and PFGE was carried out with running conditions recommended for S ...
-
No products found
because this supplier's products are not listed.
Joshua T. Cohen, et al.,
bioRxiv - Immunology 2021
Quote:
... Samples were then loaded for 15 min with 2.5 µg/mL dihydrorhodamine 123 (DHR123; Cayman Chemical), a probe that fluoresces upon exposure to reactive oxygen intermediates ...
-
No products found
because this supplier's products are not listed.
Mateusz P. Czub, Ivan G. Shabalin, Wladek Minor,
bioRxiv - Biophysics 2021
Quote:
Crystallization was performed in 96-well plates (Hampton Research, HR3-123) that were set up using a Mosquito crystallization robot (TTP Labtech) ...
-
No products found
because this supplier's products are not listed.
Masahiro Enomoto, et al.,
bioRxiv - Pathology 2024
Quote:
... and then incubated overnight at 4 °C with primary antibodies directed against amino acids 15–123 of the α-Synuclein protein (1:1,000 dilution, ref: 610786, BD Biosciences) diluted in the blocking buffer ...
-
No products found
because this supplier's products are not listed.
Claire Hamilton, et al.,
bioRxiv - Immunology 2021
Quote:
... corresponding to ~100–1000 cells per well of the MALDI target plate (384 Opti-TOF 123 mm × 84 mm AB Sciex NC0318050, 1016629), and 0.8 μL of the matrix solution were deposited on the MALDI target plate ...
-
No products found
because this supplier's products are not listed.
Batkhishig Munkhjargal, et al.,
bioRxiv - Immunology 2021
Quote:
... pHCV-NS5A and pHCV-E1 (Cat: VG40278-UT, VG40284-UT, VG40279-UT from Sino biological, HK) plasmids were performed in separate wells using Lipofectamine 3000 (Cat ...
-
No products found
because this supplier's products are not listed.
Nora FK Georgiev, et al.,
bioRxiv - Microbiology 2024
Quote:
To investigate whether the putative HKs can hydrolyse ATP the ADP Glo™ Kinase Assay (Promega) was performed according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Sonam Gurung, et al.,
bioRxiv - Genetics 2022
Quote:
... injected intraperitoneally with D-luciferin firefly (15mg/ml in PBS) (L-123-10, Gold Biotechnology, Olivette, US) at a dose of 150mg/kg and imaged 5 min later with a cooled charge-coupled device (CCD ...
-
No products found
because this supplier's products are not listed.
Quynh T. Phan, et al.,
bioRxiv - Microbiology 2021
Quote:
... approximately 2×107 fungal cells were incubated with human kininogen (10 μg/ml; Molecular Innovations, Inc., Cat. # HK-TC) and/or human vitronectin (30 μg/ml ...
-
No products found
because this supplier's products are not listed.
Madeleine F. Jennewein, et al.,
bioRxiv - Immunology 2021
Quote:
... and H3 HK proteins (H3ΔTM H3N2 A/Hong Kong/4801/2014) expressed in 293 cells were purchased from Immune Technology Corp ...
-
No products found
because this supplier's products are not listed.
Seong Kyu Han, et al.,
bioRxiv - Genomics 2022
Quote:
... in HK-2 human proximal tubule cells at approximately 70% confluency in 96-well plates by using TransIT-2020 Reagent (Mirus, #5404), following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Paula Juricic, et al.,
bioRxiv - Physiology 2022
Quote:
Lipopolysaccharide-binding protein (LBP) was measured in mouse plasma samples by ELISA according to the manufacturer’s instructions (HyCult Biotech, HK: 205).
-
No products found
because this supplier's products are not listed.
Cellas A. Hayes, et al.,
bioRxiv - Neuroscience 2021
Quote:
... cells were grown on a T-75 flasks pre-coated with Cell Attachment Factor Solution (123-100, Cell Applications), in 15mL of RBMVEC growth medium (R819-500) ...
-
No products found
because this supplier's products are not listed.
Pawel Sledzinski, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The magnetic bead mixes were prepared by combining equal parts of Sera-Mag Carboxyl hydrophilic and hydrophobic particles (09-981-121 and 09-981-123, GE Healthcare). The bead mix was washed three times with MS-grade water and resuspended in a working concentration of 10 µg/µl ...
-
No products found
because this supplier's products are not listed.
Abu Hasanat Md Zulfiker, et al.,
bioRxiv - Cell Biology 2020
Quote:
Human SH3 domain nucleotides (hLynSH3, amino acids 63-123) were amplified by PCR and cloned into a mammalian expression vector pEBG (Addgene, plasmid # 22227) with an N-terminal glutathione S-transferase (GST ...
-
No products found
because this supplier's products are not listed.
Matthew Lee, et al.,
bioRxiv - Microbiology 2021
Quote:
... The GC was fitted with DB5 (30 m × 0.32 mm (internal diameter) × 0.25 μm (film thickness) column (Agilent technologies, part # 123-5062). The carrier gas (He ...
-
No products found
because this supplier's products are not listed.
Robert J. Mobley, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 1 mg of nuclear extract was deposited over a 14-mL 10-30% glycerol gradient prepared with HK buffer in a 14× 95-mm centrifuge tube (Beckman Coulter, Brea, CA Cat. # 344060) by using the Biocomp Gradient Station (Fredericton ...
-
No products found
because this supplier's products are not listed.
Ganesh B. Chand, et al.,
bioRxiv - Neuroscience 2021
Quote:
... NY) in a Hypercassette ARG cassette (Cytiva, Amersham, UK) for 30 days along with an ART-123 Tritium Standards (American Radiolabeled Chemicals, St Louis, MO). The film was processed using a Kodak film developer (Kodak ...
-
No products found
because this supplier's products are not listed.
Chiho Kishida, et al.,
bioRxiv - Microbiology 2024
Quote:
... and 13 d of age and further cultured in liquid media containing HK-OP mixed with blue food dye (Acid Blue 9; Tokyo Chemical Industry, 5% [wt/vol] in NGM liquid solution) at 25 °C for 3 h ...