-
No products found
because this supplier's products are not listed.
Lucie Olejníková-Ladislavová, et al.,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
The 5-HT2C antagonist 6-Chloro-2,3-dihydro-5-methyl-N-[6-[(2-methyl-3-pyridinyl)oxy]-3-pyridinyl]-1H-indole-1-carboxamide dihydrochloride (SB242084; Sigma Aldrich) at a dose of 1.0 mg/kg.
-
No products found
because this supplier's products are not listed.
Helen Carrasco Hope, et al.,
bioRxiv - Immunology 2020
Quote:
... 4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY™-C16, Invitrogen, 1μM, 30min) or kynurenine (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Tudor Selescu, et al.,
bioRxiv - Physiology 2024
Quote:
... N-(3-aminopropyl)-2-{[(3-methylphenyl)methyl]oxy}-N-(2-thienylmethyl)benzamide hydrochloride salt (AMTB, Tocris #3989) 10 mM in H2O ...
-
No products found
because this supplier's products are not listed.
Luisa Saecker, Hanns Häberlein, Sebastian Franken,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... methyl ester (βARK1/GRK2 inhibitor; Cayman Chemicals, 24269-96-3), capadenoson (Cayman Chemicals ...
-
No products found
because this supplier's products are not listed.
Adetunji Alex Adekanmbi, et al.,
bioRxiv - Microbiology 2021
Quote:
... and analysed as fatty acid methyl esters by gas chromatography (Agilent 6890N ...
-
No products found
because this supplier's products are not listed.
Sarah E Hancock, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... A 37-component fatty acid methyl ester standard (Merck Life Sciences) containing an additional 3.184 nmol of methyl nonadecanoate was concurrently subjected to the same derivatisation procedure and used as an external quality control for fatty acid identification by LC-MS ...
-
No products found
because this supplier's products are not listed.
Lea-Marie Jenster, et al.,
bioRxiv - Immunology 2022
Quote:
... bestatin methyl ester (Abcam), blasticidin (InvivoGen) ...
-
No products found
because this supplier's products are not listed.
Fangrong Zhang, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 3-(trimethylsilyl) propionic acid-2,2,3,3-d4 sodium salt (TSP) from Alfa Aesar (Karlsruhe, Germany), deuterium oxide (2H2O ...
-
No products found
because this supplier's products are not listed.
Hao Hu, et al.,
bioRxiv - Plant Biology 2022
Quote:
An authentic standard of lesquerolic acid methyl ester was purchased from Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Jia-Shuo Yang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... fluo-3 acetoxymethyl (Fluo-3 thereafter) ester (Biotium, US) following a protocol adapted from (Zhang et al. ...
-
No products found
because this supplier's products are not listed.
Scarlett J Barker, et al.,
bioRxiv - Neuroscience 2023
Quote:
... in pH 6.0 PBS buffer (2.5 ml) was added a solution of 3-maleimidopropionic acid N-hydroxysuccinimide ester (MCOSu, 10 eq., TCI Chemicals) in DMF (2.5 ml) ...
-
No products found
because this supplier's products are not listed.
Kanishk Jain, et al.,
bioRxiv - Biochemistry 2023
Quote:
... to S-adenosyl-L-[methyl-3H]-methionine ([methyl-3H]-SAM) (PerkinElmer)] ...
-
No products found
because this supplier's products are not listed.
Sandra M. Holmberg, et al.,
bioRxiv - Microbiology 2023
Quote:
... Slides were run in 3% acetic acid (VWR Chemicals) and stained with Alcian blue (Sigma‒Aldrich ...
-
No products found
because this supplier's products are not listed.
Suk-Heung Song, et al.,
bioRxiv - Cell Biology 2024
Quote:
... The samples were prepared using 500uL of sample mixed with 500uL of an NMR buffer containing a chemical shift reference and analytical standard (TSP-2, 2, 3, 3-d4 (D,98% Sodium-3-Trimethylsilyl-Propionate, Cambridge Isotope Laboratories, Inc.). The NMR buffer was prepared with Mono- and Dibasic Potassium Phosphate at 0.5M concentration and a pH of 7 ...
-
No products found
because this supplier's products are not listed.
Qinyu Hao, et al.,
bioRxiv - Cell Biology 2022
Quote:
... were pooled and coupled with either Cy®3 Mono NHS Ester (GE healthcare) or Alexa FluorTM (AF ...
-
No products found
because this supplier's products are not listed.
Taehoon Kim, et al.,
bioRxiv - Plant Biology 2024
Quote:
Methyl-seq libraries were prepared using NEBNext® Enzymatic Methyl-seq Kit (NEB) and subsequently sequenced using the NovaSeq6000 platform (Illumina ...
-
No products found
because this supplier's products are not listed.
Zihan Zhang, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4-hydroxybutyl)hexan-1-aminium (ALC-0315)were purchased from Avanti Polar Lipids, Inc ...
-
No products found
because this supplier's products are not listed.
Junghyun L. Suh, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
The effect of DMSO and methyl ester version compounds (compound 34–38) on cell viability was determined using a CellTiter-GloTM ATP detection system (Promega #7573). For testing DMSO tolerance ...
-
No products found
because this supplier's products are not listed.
Lee Admoni-Elisha, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... anti-Pan-methyl (Cell signaling, 14679), anti-GST (Abcam ...
-
No products found
because this supplier's products are not listed.
Jessica Tang, et al.,
bioRxiv - Genomics 2020
Quote:
... and template-switching oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” indicates a ribonucleic acid base and “+” indicates a locked nucleic acid base; Qiagen). cDNA was amplified using KAPA HiFi HotStart ReadyMix kit (Roche #KK2502 ...
-
No products found
because this supplier's products are not listed.
Wenjuan Yang, et al.,
bioRxiv - Immunology 2021
Quote:
... Caffeic acid phenethyl ester (CAPE) (R&D Systems), Mitoquinone (MitoQ ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
Indole-3-acetic acid (auxin) (MP Biomedicals 102037) was added to the medium either 6 (SCC1-AID ...
-
No products found
because this supplier's products are not listed.
Ana Lago-Maciel, et al.,
bioRxiv - Biochemistry 2024
Quote:
... ethyl methyl sulfide (EMS), dimethyl sulfide (DMS) ...
-
No products found
because this supplier's products are not listed.
Sarah Ennis, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Carboxyfluorescein succinimidyl ester (CFSE) (Biolegend) was dissolved in dimethyl sulfoxide (DMSO) ...
-
No products found
because this supplier's products are not listed.
Kevin C. Wilkins, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 500 mM Auxin (Indole-3-acetic acid) in DMSO (Corning #25950CQC) or DMSO alone were added at a 1:1000 dilution to the media ...
-
No products found
because this supplier's products are not listed.
Markus Brandhofer, et al.,
bioRxiv - Immunology 2022
Quote:
... Biotinylated human MIF was produced using D-biotinoyl- ε -aminocaproic acid-N-hydroxy-succinimide ester (Biotin-7-NHS) with the Biotin Protein Labeling Kit from Roche (Mannheim, Germany). Alternatively ...
-
No products found
because this supplier's products are not listed.
Jiaqing Yi, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... or methyl green (H-3402, Vector Laboratories). For immunofluorescent staining ...
-
No products found
because this supplier's products are not listed.
Cristiane Miranda Franca, et al.,
bioRxiv - Bioengineering 2022
Quote:
... acid solubilized Type 1 collagen from rat tail tendon (3 mg/mL, BD Biosciences) was reconstituted in an ice bath to a final concentration of 2.5 mg/mL ...
-
No products found
because this supplier's products are not listed.
Angela C. Debruyne, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Poly(methyl methacrylate-co-methacrylic acid) (PMMA-MA; 10% methacrylic acid, MW ∼100,000 Da, 17913-500) was from Polysciences (USA), organic solvents were obtained from Carl Roth (Austria) ...
-
No products found
because this supplier's products are not listed.
Bradley M. Readnour, et al.,
bioRxiv - Microbiology 2021
Quote:
... succinimidyl ester)-LPSXG-(5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid) (Edans) peptides were provided by GenScript (Piscataway, NJ). Six peptide sequences were selected for study ...
-
No products found
because this supplier's products are not listed.
Seth D. Reighard, et al.,
bioRxiv - Immunology 2020
Quote:
... Following enumeration using 3% acetic acid with methylene blue (StemCell Technologies), splenocytes were resuspended in phosphate-buffered saline and forty to sixty million cells were injected either intraperitoneally or intravenously (via retro-orbital injection under isoflurane anesthesia ...
-
No products found
because this supplier's products are not listed.
Hiroyuki Okada, et al.,
bioRxiv - Genomics 2024
Quote:
Pico Methyl-Seq Library Prep Kit (Zymo research) was used for making WGBS libraries basically as manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Rasheduzzaman Rashu, et al.,
bioRxiv - Immunology 2023
Quote:
... with 50 μg of the Toll-like receptor (TLR)3 agonist polyinosinic-polycytidylic acid [poly (I:C)] (InvivoGen), 50 μg of the TLR7 agonist imiquimod (InvivoGen) ...
-
No products found
because this supplier's products are not listed.
Y. Edrei, et al.,
bioRxiv - Genomics 2021
Quote:
Methyl-seq-captured libraries were sequenced using a Hiseq2500 device (Illumina), by applying paired-end 125bp reads ...
-
No products found
because this supplier's products are not listed.
Weiwei Peng, et al.,
bioRxiv - Immunology 2023
Quote:
... in non-reducing conditions and run at 120 V in 3-Morpholinopropane-1-sulfonic acid (MOPS) buffer (Bio-rad). Bands were visualized with Imperial Protein Stain (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Raphael Aguillon, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... The PCR products were then loaded and migrated by electrophoresis on a 3% Tris-borate-EDTA (TBE) agarose gel supplemented with GelStar Nucleic Acid Gel Stain (Lonza) for approximately one hour ...
-
No products found
because this supplier's products are not listed.
Sofie E. Pedersen, et al.,
bioRxiv - Neuroscience 2024
Quote:
... myoinositol (3) and ascorbic acid (0.5) using a vibratome (Leica VT1200, Germany). Brains slices were transferred to an interface type holding chamber filled with 28 °C carbogen saturated ASCF containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Eric T. Hall, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
No products found
because this supplier's products are not listed.
Jia Nong, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... and 0.1% v/v trifluoroacetic acid and running through a C8 column (Eclipse XDB-C8, 3 μm, 3.0×100 mm, Phenomenex) at a flow rate of 0.6 mL/minute ...
-
No products found
because this supplier's products are not listed.
Parham Ramezani-Rad, et al.,
bioRxiv - Immunology 2024
Quote:
... The reaction was stopped with 2N of sulfuric acid (Ricca Chemical Cat# 8310-32) and read at 450 nm on a FlexStation 3 plate reader (Molecular Devices).
-
No products found
because this supplier's products are not listed.
Mina N. F. Morcos, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Interleukin-3 (rmIL-3 20ng/ml, PeproTech), Erythropoietin (rhEPO ...
-
No products found
because this supplier's products are not listed.
John R. Ferrarone, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The alleles also contain mutations that confer resistance to CRISPR/Cas9 editing (without changing the amino acid sequence) with all the sgRNAs against LKB1 in the Toronto Knockout version 3 (TKOv3) CRISPR library (Addgene 125517, a gift from Jason Moffat). These alleles were then cloned into pBABE-GFP (Addgene 10668 ...
-
No products found
because this supplier's products are not listed.
Sashi Kant, et al.,
bioRxiv - Microbiology 2022
Quote:
Consumption of O2 was measured using an ISO-OXY-2 O2 sensor attached to an APOLLO 4000 free radical analyzer (World Precision Instruments, Inc., Sarasota, FL) as described52 ...
-
No products found
because this supplier's products are not listed.
Raianna F. Fantin, et al.,
bioRxiv - Immunology 2024
Quote:
... Plates were developed for 10 minutes at room temperature and then the reaction was stopped by adding 50 μL 3 M hydrochloric acid (HCl, Fisher) and plates were read using a Synergy 4 (BioTek) plate reader at an optical density (OD ...
-
No products found
because this supplier's products are not listed.
Tegan S. Horan, et al.,
bioRxiv - Genetics 2023
Quote:
... the cell pellet was resuspended in PBS supplemented with 2 % FCS and nucleated cells were counted in methylene blue with 3 % acetic acid on a Vi-Cell XR cell viability counter (Beckman Coulter). 10 × 106 bone marrow cells were resuspended in 200 μl of PBS supplemented with 2 % FCS containing the following antibody solution ...
-
No products found
because this supplier's products are not listed.
Timm O. Koller, et al.,
bioRxiv - Biochemistry 2022
Quote:
Grids (Quantifoil R3/3 Cu300 with 3 nm holey carbon) were glow discharged and 4 µL of sample (8 OD260/mL ...
-
No products found
because this supplier's products are not listed.
Lina Hacker, et al.,
bioRxiv - Bioengineering 2020
Quote:
DNA was isolated from liver samples of female C57BL/6J mice (3-4 months; n=3) and Wistar rats (6-9 months; n=3) (Charles River) using the Qiagen DNeasy Blood/Tissue kit following the manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Vidur Garg, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... + 3% donkey serum (Jackson ImmunoResearch)] at room temperature for 15 mins ...
-
No products found
because this supplier's products are not listed.
Allen K. Kim, Helen D. Wu, Takanari Inoue,
bioRxiv - Cell Biology 2020
Quote:
... filter wheels (Lambda 10-3, Sutter Instruments), and LED light source (pE-300 ...