-
No products found
because this supplier's products are not listed.
Alexandre Brenet, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Bixafen, (N-(3’,4’-dichloro-5-fluorobiphenyl-2-yl)-3-(difluoromethyl)-1-methylpyrazole-4-carboxamide) (Bixafen, (Sigma-Aldrich, St ...
-
No products found
because this supplier's products are not listed.
Huamei Forsman, et al.,
bioRxiv - Immunology 2024
Quote:
... The FFA2R antagonist CATPB ((S)-3-(2-(3-Chlorophenyl)acetamido)-4-(4-(trifluoromethyl) phenyl) butanoic acid) was from Tocris Bioscience (Bristol ...
-
No products found
because this supplier's products are not listed.
Eun-Ji Kim, et al.,
bioRxiv - Plant Biology 2022
Quote:
... N-(3-triethylammoniumpropyl)-4-(6-(4-(diethylamino) phenyl) hexatrienyl) pyridinium dibromide (FM 4-64; 50 μM) (Invitrogen) or propidium iodide (PI ...
-
No products found
because this supplier's products are not listed.
Romain D. Cazé, et al.,
bioRxiv - Neuroscience 2023
Quote:
D-AP5 (D-(−)-2-Amino-5-phosphonopentanoic acid) and SR 95531 (2-(3-Carboxypropyl)-3-amino-6-(4 methoxyphenyl) pyridazinium bromide) were purchased from Abcam, UK ...
-
No products found
because this supplier's products are not listed.
Neeraja Purandare, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... and the remaining compounds (4-Aminobenzanilide, 4-Amino salicylic acid, benzanilide, phenyl benzoate, and phenyl salicylic acid) were from Santa Cruz Biotechnology (Dallas ...
-
No products found
because this supplier's products are not listed.
Simon H.J. Brown, James C. Bouwer, Scott B. Cohen,
bioRxiv - Molecular Biology 2023
Quote:
... 4-Amino-1-butanol (#178330) and 3- glycidoxypropyltrimethoxysilane (#440167) were obtained from Merck. Gold nanoparticle- PEG-amine conjugate was custom-synthesized by NanoPartz (Loveland CO ...
-
No products found
because this supplier's products are not listed.
Dounia Dems, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Fmoc-(4-amino)benzoic acid and Fmoc-(4-aminomethyl)benzoic acid were purchased from VWR and Chem-Impex International Inc. ...
-
No products found
because this supplier's products are not listed.
Clara R. Stelman, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
No products found
because this supplier's products are not listed.
Gregory W. Busey, et al.,
bioRxiv - Immunology 2023
Quote:
VPC01091.1 [((1R,3S)-1-amino-3-(4-octylphenyl)cyclopentyl)methanol] is commercially available (Avanti Polar Lipids, 857345). VPC01091.2-P [((1S,3S)-1-amino-3-(4-octylphenyl)cyclopentyl)methyl dihydrogen phosphate] ...
-
No products found
because this supplier's products are not listed.
Liang Wang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
No products found
because this supplier's products are not listed.
John Ong, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 10μM of 2-(4-Morpholinyl)-8-phenyl-4 H-1-benzopyran-4-one (Ly294002: Promega, #V120A), 50ng/ml of Activin A (Stemcell Technologies ...
-
No products found
because this supplier's products are not listed.
Rahul Bhattacharjee, et al.,
bioRxiv - Cell Biology 2022
Quote:
... cells were grown in YES at 32°C to mid-log phase and treated with 4-amino-1-tert-butyl-3-(3-methylbenzyl)pyrazolo[3,4-3]pyrimidine (3MB-PP1) (Toronto Research Chemical; A602960 or Cayman Chemical; 17860) at a final concentration of 15 µM for 30 min ...
-
No products found
because this supplier's products are not listed.
Alison L. Wong, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 3% paraformalydehyde (15754-S, EMS) and 0.1 M Sorensen’s phosphate buffer pH 7.2 solution ...
-
No products found
because this supplier's products are not listed.
Elias Adriaenssens, et al.,
bioRxiv - Cell Biology 2024
Quote:
... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798; RRID:Addgene_223799 ...
-
No products found
because this supplier's products are not listed.
Rebecca E Schmitt, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Passaging occurred every 3-4 days using ReLeSR (STEMCELL Technologies) and DPBS 1X (Gibco ...
-
No products found
because this supplier's products are not listed.
Queralt Vallmajo-Martin, et al.,
bioRxiv - Cell Biology 2024
Quote:
... and 3-4 µl of Matrigel (Corning, 356231 ...
-
No products found
because this supplier's products are not listed.
Patricia Vit, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 2,2,3,3-d(4)-3- (trimethylsilyl)propionic acid sodium salt (TSP) by Alfa Aesar (Karlsruhe, Germany), potassium dihydrogen orthophosphate (KH2PO4) ...
-
No products found
because this supplier's products are not listed.
Jayanth Venkatarama Reddy, et al.,
bioRxiv - Bioengineering 2024
Quote:
... The amino acids were derivatized with OPA for primary amino acids and FMOC for secondary amino acids as per the protocol provided by Agilent. Derivatization was performed on the autosampler ...
-
No products found
because this supplier's products are not listed.
Mei Hong Liu, et al.,
bioRxiv - Genomics 2023
Quote:
... 3 µL 10x NEBuffer 4 (NEB), 3 µL of 1 mM each dATP/ddCTP/ddGTP/ddTTP (dATP/ddBTP ...
-
No products found
because this supplier's products are not listed.
Andri Vasou, et al.,
bioRxiv - Immunology 2021
Quote:
... sonicated at 4°C with 3 cycles of 30 s on 30 s off in a Bioruptor Pico (Diagenode) and clarified by centrifugation at 12,000 × g ...
-
No products found
because this supplier's products are not listed.
Margarita Anisimova, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The patch electrodes (3-4 MΩ, World Precision Instruments; 1B150F-3) were filled with intracellular solution containing ...
-
No products found
because this supplier's products are not listed.
Aurélien Sutra Del Galy, et al.,
bioRxiv - Immunology 2021
Quote:
... 2.106 T cells were resuspended in 20 µl of nucleofection solution with 3 µl or 4 µl RNP and transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Murine T cells were electroporated using the DN110 program of 4D nucleofector (4D-Nucleofector Core Unit ...
-
No products found
because this supplier's products are not listed.
M. Eugenia Dieterle, et al.,
bioRxiv - Microbiology 2020
Quote:
... coated with PBS alone or with 2 µg/ml of SARS-CoV-2 S protein in PBS overnight at 4°C were blocked for 1 hour with 3% nonfat dry milk (Biorad) in PBS ...
-
No products found
because this supplier's products are not listed.
Mathieu Ferrari, et al.,
bioRxiv - Immunology 2021
Quote:
... 3 or 4 of a Series S CM5 chip (GE Healthcare) functionalised with an anti-His capture kit (GE Healthcare ...
-
No products found
because this supplier's products are not listed.
Alberto Herrera, et al.,
bioRxiv - Immunology 2024
Quote:
... #3 and #4 (Biolegend) were spiked into individual samples ...
-
No products found
because this supplier's products are not listed.
Wenliang Wang, et al.,
bioRxiv - Bioengineering 2023
Quote:
3-4 months old Long-Evans Rats (Charles River) were used in our experiments ...
-
No products found
because this supplier's products are not listed.
Antonio Marino, et al.,
bioRxiv - Systems Biology 2023
Quote:
... 4 3 2.0 mm SecurityGuard (Phenomenex) cartridge as a guard column ...
-
No products found
because this supplier's products are not listed.
Tulika Singh, et al.,
bioRxiv - Immunology 2021
Quote:
... CD38 APC-AF700 (clone LS198-4-3; Beckman Coulter), CD19 APC-Cy7 (clone SJ25C1 ...
-
No products found
because this supplier's products are not listed.
Katja Ester, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 3 μM Fluo-4 AM dye (BD Biocsiences). After 60 min incubation in the dark at 37 °C ...
-
No products found
because this supplier's products are not listed.
Amin Addetia, et al.,
bioRxiv - Immunology 2023
Quote:
... The full-length BQ.1.1 S construct containing a 21 amino acid C-terminal deletion was generated by mutagenesis of the BA.4/5 S construct by Genscript.
-
No products found
because this supplier's products are not listed.
Michael J. Hoy, et al.,
bioRxiv - Microbiology 2022
Quote:
Female A/J (3- to 4-week-old; Jackson Labs) mice were anesthetized utilizing an isoflurane chamber ...
-
No products found
because this supplier's products are not listed.
Daniel Franjic, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and rotor (Eppendorf #S-4-72). Upon end of centrifugation ...
-
No products found
because this supplier's products are not listed.
Jeremy A. Herrera, et al.,
bioRxiv - Pathology 2021
Quote:
... Slides were then treated with 3-4% hydrogen peroxide (Leica Biosystems RE7101) for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Calida Mrabti, et al.,
bioRxiv - Physiology 2024
Quote:
... NEL105001EA).Antibodies: mouse OCT-3/4 (C-10) (1:3000, Cell Signaling, 13969); mouse β-Actin (AC-74 ...
-
No products found
because this supplier's products are not listed.
Eric T. Hall, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
No products found
because this supplier's products are not listed.
Lamuk Zaveri, Jyotsna Dhawan,
bioRxiv - Cell Biology 2021
Quote:
... Klf4 or Oct-3/4 or Klf4 + Oct-3/4 or Klf4 + OctER using PEI (Polysciences, USA). Self-ligated empty pGEM-T vector (Promega ...
-
No products found
because this supplier's products are not listed.
Johanna Theruvath, et al.,
bioRxiv - Immunology 2021
Quote:
... 4 minutes after 3 mg d-luciferin (PerkinElmer) was injected intraperitoneally ...
-
No products found
because this supplier's products are not listed.
Yuki Kondo, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 3-amino-9-ethylcarbazole (Vector Laboratories, Inc.) was used as a substrate for visualization ...
-
No products found
because this supplier's products are not listed.
Stephanie S. Kim, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ...
-
No products found
because this supplier's products are not listed.
Pamela L. Graney, et al.,
bioRxiv - Immunology 2020
Quote:
... 1% P/S and 10 ng/mL interleukin-4 (IL-4, Peprotech) was added to each organoid ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
Indole-3-acetic acid (auxin) (MP Biomedicals 102037) was added to the medium either 6 (SCC1-AID ...
-
No products found
because this supplier's products are not listed.
Lara Taniguchi, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Borosilicate glass pipettes (3–4 MΩ, Molecular Devices) filled with internal solution (295–305 mOsm ...
-
No products found
because this supplier's products are not listed.
Valentina Salvi, et al.,
bioRxiv - Immunology 2021
Quote:
... and PE-conjugated anti-IL-4 (clone 7A3-3, Miltenyi Biotec) following the manufacturer’s recommendations ...
-
No products found
because this supplier's products are not listed.
Roshan X Norman, et al.,
bioRxiv - Cell Biology 2024
Quote:
... at 200 nm intervals every 3-15 s using Elements software (Nikon, version 5.20) and a 60x/1.5NA (Plan Apo ...
-
No products found
because this supplier's products are not listed.
Raianna F. Fantin, et al.,
bioRxiv - Immunology 2024
Quote:
... Plates were developed for 10 minutes at room temperature and then the reaction was stopped by adding 50 μL 3 M hydrochloric acid (HCl, Fisher) and plates were read using a Synergy 4 (BioTek) plate reader at an optical density (OD ...
-
No products found
because this supplier's products are not listed.
Piyush Daga, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4% (3-Aminopropyl)triethoxysilane(APTES)-treated and 2% glutaraldehyde-activated glass-bottom dishes (Ibidi) were used to cast polyacrylamide (PAA ...
-
No products found
because this supplier's products are not listed.
Timothy J. Mottram, et al.,
bioRxiv - Microbiology 2023
Quote:
... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
No products found
because this supplier's products are not listed.
J. Christopher Rounds, et al.,
bioRxiv - Neuroscience 2021
Quote:
... brains were left rocking at 4°C for 1-3 nights in 0.1% PBS-T supplemented with blocking agent normal goat serum (Jackson ImmunoResearch) at a 1:20 dilution ...
-
No products found
because this supplier's products are not listed.
Narayan Pokhrel, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Signal was detected in the embryos by fluorescence microscope (model SZX2-ILLK, Olympus; Figure 4-figure supplement 3).
-
No products found
because this supplier's products are not listed.
Jenny Sachweh, et al.,
bioRxiv - Cell Biology 2024
Quote:
3 µl cell suspension was applied on glow-discharged (Pelco easiGlow) R1/4 SiO2 gold 200 mesh grids (Quantifoil), blotted for 10 sec from the backside and plunge-frozen on a Leica EM GP2 plunger at 23 °C ...