-
No products found
because this supplier's products are not listed.
Eleanor Minogue, et al.,
bioRxiv - Immunology 2022
Quote:
... To asses mitochondrial fuel usage OCR was measured subsequent to the addition of the following drugs in different combinations as indicated: 3 μM bis-2-(5-phenylacetamido-1,3,4-thiadiazol-2-yl)ethyl sulfide (BPTES) (SML0601, Sigma), 2 μM UK-5099 (PZ0160 ...
-
No products found
because this supplier's products are not listed.
James Pelletier, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 micromols sodium sulfo-NHS and 5 micromols 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (Thermo Fisher #22980) in 10 μL of DMSO ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Qian Chen, et al.,
bioRxiv - Genomics 2020
Quote:
... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
No products found
because this supplier's products are not listed.
Nitin Wadhwani, et al.,
bioRxiv - Cancer Biology 2022
Quote:
SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Nienke Willemsen, et al.,
bioRxiv - Pathology 2022
Quote:
... and Proteasome 20S alpha 1+2+3+5+6+7 (Abcam, ab22674). After washing with TBS-T (200 mM Tris (Merck) ...
-
No products found
because this supplier's products are not listed.
Lucie Olejníková-Ladislavová, et al.,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
The 5-HT1A antagonist N-[2-[4-(2-Methoxyphenyl)-1-piperazinyl]ethyl]-N-2-pyridinylcyclohexanecarboxamide maleate (WAY100635; Tocris Bioscience) at a dose of 1.0 mg/kg.
-
No products found
because this supplier's products are not listed.
Neta Erez, et al.,
bioRxiv - Cell Biology 2020
Quote:
E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
No products found
because this supplier's products are not listed.
Xinjian Yu, et al.,
bioRxiv - Genomics 2024
Quote:
... included 1.11 μM N7XX (5′-CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTCTCGTGGGCTCGG-3′) and S5XX (5′-AATGATACGGCGACCACCGAGATCTACACXXXXXXXXTCGTCGGCAGCGTC-3′) primers (384PP_AQBP) in 2× HiFi HotStart ReadyMix (Roche, KK2602, 6RES_GPSA). Dual barcode sequences in primers are denoted by “XXXXXXXX.” Unique dual barcode combinations for each well of a 384-well plate were achieved by dispensing 16 unique N7XX barcodes across each row and 24 unique S5XX barcodes across each column ...
-
No products found
because this supplier's products are not listed.
Marco S. Kaiser, et al.,
bioRxiv - Physiology 2021
Quote:
... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
No products found
because this supplier's products are not listed.
Jana Hucklenbroich, et al.,
bioRxiv - Plant Biology 2021
Quote:
... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
No products found
because this supplier's products are not listed.
Corina M. Stewart, et al.,
bioRxiv - Microbiology 2022
Quote:
... 5-(N-ethyl-N-isopropyl)-Amiloride (EIPA, Cayman Chemical), and Akt Inhibitor VIII (Cayman Chemical ...
-
No products found
because this supplier's products are not listed.
Kathleen E. McGrath, et al.,
bioRxiv - Cell Biology 2024
Quote:
... IL-3 (5 ng/ml, Peprotech), and cholesterol-rich lipids (40 mg/mL ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Yu Ti Cheng, et al.,
bioRxiv - Plant Biology 2023
Quote:
Roughly 30,000 Arabidopsis bak1-5 bkk1-1 cerk1-2 (bbc) seeds were mutagenized using 0.2% ethyl methanesulfonate (EMS). Mutagenized M1 seeds were sown on soil and allowed to grow to set seeds ...
-
No products found
because this supplier's products are not listed.
Stephanie S. Kim, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ...
-
No products found
because this supplier's products are not listed.
Ashley N. Anderson, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... followed by 3 x 5 minute washes in 2 × SSC (BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Patricia Bilodeau, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5’-ATAAGCTCCCTGCCCGAGTC-3’ (Santa Cruz sc-430739).
-
No products found
because this supplier's products are not listed.
Buse Baran, et al.,
bioRxiv - Plant Biology 2024
Quote:
... Guide RNA sequences “5-CGUGUCACGACGGAGUGGAU-3” and “5-AUGUUGUAUGUGCCUAUACG-3” were synthesized by GenScript by adding the Cas12a scaffold sequence (5-UAAUUUCUACUCUUGUAGAU-3 ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
Valentina Fajner, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... CG42797EcoRI_F: 5’-CCGgaattcATGGAGCCACCAGCT-3’ and CG42797XhoI_R: 5’-TAGAGGTACCctcgagCTACTCAATGCCGAACGTGTTG-3’ and cloned by enzymatic digestion into a pGEX6P1(GE Healthcare).
-
No products found
because this supplier's products are not listed.
Amanda N.D. Adams, et al.,
bioRxiv - Microbiology 2021
Quote:
... 200µg/ml 5’-fluoro-2’-deoxyuridine (VWR), 100ng/ml anhydrotetracycline (Sigma) ...
-
No products found
because this supplier's products are not listed.
Biao Qiu, Olga Boudker,
bioRxiv - Biophysics 2024
Quote:
... 4 mg/ml liposomes comprising 5:5:2 (w:w) 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC, Avanti Polar Lipids), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE ...
-
No products found
because this supplier's products are not listed.
Troy N. Trevino, et al.,
bioRxiv - Immunology 2022
Quote:
... 5 ng/mL IL-2 (Biolegend 575404) was added to media and cells were cultured another 2 days (Lutz et al. ...
-
No products found
because this supplier's products are not listed.
Catherine F. Ruff, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-diaminobenzidine plus nickel (DAB; Vector Laboratories Kit; 2-5 min reaction). Sections were washed in 0.1M cacodylate buffer and postfixed with 1% osmium and 1.5% potassium ferrocyanide in cacodylate buffer for 1 hr at RT after sections were dehydrated in an ascending gradient of ethanol (ETOH ...
-
No products found
because this supplier's products are not listed.
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Addgene)[70] in a ratio of 5:3:2 using polyethylenimine (24765-2, Polysciences). Virus supernatant was harvested 30 h after transfection ...
-
No products found
because this supplier's products are not listed.
Maria C. Sterrett, et al.,
bioRxiv - Genetics 2022
Quote:
... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
No products found
because this supplier's products are not listed.
Umit Akkose, et al.,
bioRxiv - Genomics 2020
Quote:
... and 1 μCi of [α-32P]-3’-deoxyadenosine 5’-triphosphate (cordycepin 5’-triphosphate, Perkin Elmer Life Sciences) in 1× terminal deoxynucleotidyl transferase buffer (New England Biolabs) ...
-
No products found
because this supplier's products are not listed.
Valentina Gandin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... using the following two primer sequences (T7 Forward: 5’-TAATACGACTCACTATAGCGTCATC-3’; Reverse: 5’-TTGTCGCACGTTCGGTGTCG-3’) and purified with DNA Clean and Concentrator-5 Kit (Zymo Research, 11-302). dsDNA was converted to RNA with HiScribe™ T7 High Yield RNA Synthesis Kit (NEB ...
-
No products found
because this supplier's products are not listed.
Jiachao Xu, et al.,
bioRxiv - Cell Biology 2024
Quote:
... individual cells were imaged every 1.5 or 2 s for a duration of 3 or 5 min in phenol-free DMEM/F12 (Corning) containing 5% FBS and 20 mM HEPES ...
-
No products found
because this supplier's products are not listed.
Jennifer S. Chen, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 3 dpi by high content imaging (BioTek Cytation 5) configured with brightfield and GFP cubes ...
-
No products found
because this supplier's products are not listed.
Kamal Mandal, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 5 mg of C18 solid phase (3 μm, Durashell, Phenomenex). The HpHt column was sequentially washed with a series of 3 different solvents/solutions namely methanol ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Lisa K. Engelbrecht, et al.,
bioRxiv - Cell Biology 2021
Quote:
... for 5 min followed by a 3 min treatment with 5 mg/mL dispase (Stem Cell Technologies, 07913) and 1 mg/mL DNase I (Sigma ...
-
No products found
because this supplier's products are not listed.
X. Rosa Ma, et al.,
bioRxiv - Neuroscience 2021
Quote:
... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
No products found
because this supplier's products are not listed.
Nioosha Nekooie-Marnany, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Cy-3 or Cy-5 (Jackson Immunoresearch Laboratories), and processed for DAPI or Hoechst staining to visualize cells’ nuclei before mounting in ImmuMount medium (Shandon) ...
-
Prepared to contain higher collagenase and caseinase activities. A dialyzed, lyophilized powder.
Cat# LS005282,
1 gm, $246.00
Ask
Luke R. Perreault, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Minced tissue underwent 3-5 serial digestions in collagenase type 2 (Worthington Biochemical Corp, Lakewood, NJ) in sterile PBS with 20 mM glucose ...
-
No products found
because this supplier's products are not listed.
Rayan Khaddaj-Mallat, et al.,
bioRxiv - Neuroscience 2021
Quote:
Pericytes viability was assessed using the 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) assay according to the manufacturer’s procedure (Cell Signaling Technology). Cells were plated at the appropriate concentration in 96-well plates under different experimental conditions ...
-
No products found
because this supplier's products are not listed.
Max D. Knickmeyer, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Embryos were examined at 3-5 dpf using a stereomicroscope (Nikon SMZ18) with a light source for fluorescence ...
-
No products found
because this supplier's products are not listed.
Mirushe H. Miftari, Bernt T. Walther,
bioRxiv - Developmental Biology 2022
Quote:
... embryos were paraffin-embedded and serially sectioned at 3-5 µm (Leica microtome), before attachment to poly-L-lysine-coated glass slides (Sigma ...
-
No products found
because this supplier's products are not listed.
Nicolò Mangraviti, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and 5 ng/ml human FGF-2 (Miltenyi Biotec). Then ...
-
No products found
because this supplier's products are not listed.
Jia Li, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and NEMO (excitation: 490 ± 5 nm; emission: 520 ± 5 nm) fluorescence were measured with a Flexstation 3 microplate reader (Molecular Devices, USA) controlled by SoftMax Pro v7.x ...
-
No products found
because this supplier's products are not listed.
Yoichi Araki, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or Spinning disk confocal microscopes controlled by axiovision software (Carl Zeiss; Fig. 2, 3, and 5). Following 5-10 min of baseline recording ...
-
No products found
because this supplier's products are not listed.
Shuang-yong Xu, et al.,
bioRxiv - Microbiology 2021
Quote:
... His-tagged SARS-CoV-2 Spike protein (5 μl) or His-tagged RBD protein (5 μl at 1.75 μg/μl, purchased from Sino Biological) were first diluted in 45 μl of MBP binding buffer ...
-
No products found
because this supplier's products are not listed.
Suha Naffar-Abu Amara, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 3 and 5 and counted using a particle counter (Z1; Beckman Coulter, Inc.). Experiments were carried out in triplicate ...
-
No products found
because this supplier's products are not listed.
Jose Ernesto Canton-Josh, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 2-5 mW) delivered through a 60X water-immersion objective (Olympus, Tokyo, Japan) with CoolLED PE4000 widefield illumination (CoolLED Ltd. ...
-
No products found
because this supplier's products are not listed.
Samuel Hume, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and using 5 μg anti-NUCKS1 antibody (ProteinTech 12023-2-AP) or 5 μg normal rabbit IgG (SantaCruz sc2027) ...
-
No products found
because this supplier's products are not listed.
Maria Chechik, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The most concentrated fraction was spun for 5 min at 13K rpm before applying 3 µL to UltraAuFoil R1.2/1.3 gold support grids (Quantifoil). Prior to sample applications grids were glow-discharged for 3 min in Pelco easiGlow glow-discharger (Pelco ...