-
No products found
because this supplier's products are not listed.
Brae M Bigge, Prachee Avasthi,
bioRxiv - Cell Biology 2022
Quote:
... 100 μM (2’Z,3’E)-6-Bromoindirubin-3’-oxime (Sigma, B1686), 20 μM Tideglusib (Sigma ...
-
No products found
because this supplier's products are not listed.
Maria-Luisa del Rio, et al.,
bioRxiv - Immunology 2024
Quote:
... and 2 mg/ml 3-[4,5-dimethylthiazol-2-yl]-5-[3-carboxymethoxyphenyl]2-[4-sulfophenyl]-2H-tetrazolium (PMS, Promega) (1/20 ...
-
No products found
because this supplier's products are not listed.
Francis Ledesma, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium (WST-8) was purchased from ThermoFisher Scientific.
-
No products found
because this supplier's products are not listed.
Emanuela Torelli, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
(5Z)-5[(3,5-Difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2-methyl-3-(2,2,2-trifluoroethyl)-4H-imidazol-4-one (DFHBI-1T) was purchased from Tocris Bio-techne ...
-
No products found
because this supplier's products are not listed.
Annamarie E. Allen, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cells were incubated in treatment media for the indicated period of time and then MTS reagent ((3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) purchased from Abcam, (ab197010 ...
-
No products found
because this supplier's products are not listed.
Ashwin Narayanan, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... concentrations was assessed using reduction in WST-1 (4-[3-(4-Iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]- 1,3-benzene Disulfonate) to water-soluble formazan (Roche, France). Cells were seeded in 96-well plates at 2 × 104 cells/well and treated with the different NAM concentrations at 37°C ...
-
No products found
because this supplier's products are not listed.
Angélica M. González-Sánchez, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and 2′ O-methylated using Vaccinia VP39 (2′ O Methyltransferase) (NEB) in a reaction that also included 1X capping buffer (NEB) ...
-
No products found
because this supplier's products are not listed.
Pei-Li Tseng, et al.,
bioRxiv - Cell Biology 2024
Quote:
5-bromo-2-deoxyuridine (BrdU) (Merck) immunofluorescence staining was performed to assess the influence of ECM stiffness on MCF10A proliferation ...
-
No products found
because this supplier's products are not listed.
Roza Izgilov, et al.,
bioRxiv - Cell Biology 2023
Quote:
using a fluorescent glucose analog, 2-NBDG (2-Deoxy-2-[(7-nitro-2, 1, 3-benzoxadiazol-4-yl) amino]-D-glucose) (11046, Cayman chemical). Cultured 3T3-L1 cells “starved” in a glucose-free medium at 37°C for 1 hr ...
-
No products found
because this supplier's products are not listed.
Dougald M. Monroe, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 4 μM lipid vesicles (Avanti Polar Lipids PS:PC:PE 3:2:5), and FV (0 ...
-
No products found
because this supplier's products are not listed.
Martina Pauk, et al.,
bioRxiv - Physiology 2024
Quote:
5-Bromo-2-deoxyuridine (BrdU) assay was performed with BrdU (Santa Cruz Biotechnology) and anti-BrdU antibody (Santa Cruz Biotechnology) ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Bradley R Corr, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 5′-bromo-2′-deoxyuridine (BrdU) (Cat. #550891; BD Biosciences; RRID:AB_2868906) was then added directly to the well culture media (final concentration 10 µM) ...
-
No products found
because this supplier's products are not listed.
Maxence Noel, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Membranes were incubated with 2 µg/mL biotinylated lectins from Vector Labs (VVA B-1235-2, PNA B-1075-5) in conditions as previously described ...
-
No products found
because this supplier's products are not listed.
Konstadinos Moissoglu, et al.,
bioRxiv - Cell Biology 2020
Quote:
... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
John B. G. Mackey, et al.,
bioRxiv - Immunology 2021
Quote:
... Ly6B.2 (clone 7/4, Bio-Rad), CD133 (clone 13A4 ...
-
No products found
because this supplier's products are not listed.
Eszter Somogyi, et al.,
bioRxiv - Immunology 2020
Quote:
... the media were refreshed and supplemented with 5 ng/mL IL-7 or 5 ng/mL IL-7 and 4 ng/ml IL-2 (R&D Systems), respectively ...
-
No products found
because this supplier's products are not listed.
Joshua D. Kerkaert, et al.,
bioRxiv - Microbiology 2021
Quote:
... and 300μL of XTT solution was added to each well (0.5mg/mL XTT [2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide] (VWR) with 25μM menadione in PBS) ...
-
No products found
because this supplier's products are not listed.
Emily J. Talbot, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
No products found
because this supplier's products are not listed.
Rayan Khaddaj-Mallat, et al.,
bioRxiv - Neuroscience 2021
Quote:
Pericytes viability was assessed using the 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) assay according to the manufacturer’s procedure (Cell Signaling Technology). Cells were plated at the appropriate concentration in 96-well plates under different experimental conditions ...
-
No products found
because this supplier's products are not listed.
Angela Armento, et al.,
bioRxiv - Cell Biology 2024
Quote:
... bFGF 5 ng/ml (day 2-4, AF-100-18B, Peprotech), activinA 100 ng/ml (day 4-14 ...
-
No products found
because this supplier's products are not listed.
Ewa Pasquereau-Kotula, et al.,
bioRxiv - Microbiology 2023
Quote:
... anti-E-cadherin (clone ECCD-2) (Takara), goat anti-rat488 (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
Konstantinos Sofiadis, et al.,
bioRxiv - Genomics 2020
Quote:
... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Sebastian Ströh, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2% and 3% OsO4 (prepared from 2 mL 4% osmium tetroxide solution, Electron Microscopy Sciences, Hatfield, PA)
-
No products found
because this supplier's products are not listed.
Jihae Shin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
No products found
because this supplier's products are not listed.
Joost J.A.P.M. Wijnakker, et al.,
bioRxiv - Cell Biology 2024
Quote:
... and plated on a pre-coated (similar as described before, 5 µg/ml Invasin and 2% BME®, O/N, 4°C) transwell system (Greiner 12-well transparent, 3 µm pore size). TEER measurements were done using Millicell ERS-2 voltohmmeter ...
-
No products found
because this supplier's products are not listed.
Ryo Okuda, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
No products found
because this supplier's products are not listed.
Yize Li, et al.,
bioRxiv - Microbiology 2020
Quote:
... 0.25 μg /ml amphotericin B and 2% Nu serum (Corning) in the basal compartment ...
-
No products found
because this supplier's products are not listed.
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Addgene)[70] in a ratio of 5:3:2 using polyethylenimine (24765-2, Polysciences). Virus supernatant was harvested 30 h after transfection ...
-
No products found
because this supplier's products are not listed.
Abishek Chandrashekar, et al.,
bioRxiv - Microbiology 2022
Quote:
... SARS-CoV-2 (B.1.1.529) RBD proteins (Sino Biological) labeled with APC and DyLight 405 ...
-
No products found
because this supplier's products are not listed.
Sunniyat Rahman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
No products found
because this supplier's products are not listed.
Paul Renauer, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 4 x 2 mm (Phenomenex). The eluents were A ...
-
No products found
because this supplier's products are not listed.
Yu-Te Yeh, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and the post-nuclear supernatant was loaded onto an 8-step discontinuous sucrose density gradient (HEPES-buffered 0.2–2 M sucrose) and centrifuged at 55,000 rpm for 2h at 4 °C using an MLS50 rotor (Beckman Coulter). Extracellular acidification rate (ECAR ...
-
No products found
because this supplier's products are not listed.
Yoshiko Nomura, et al.,
bioRxiv - Genomics 2021
Quote:
... with 2 % MACS NeuroBrew-21 w/o Vitamin A (Miltenyi Biotec), 1X Glutamax (Gibco) ...
-
No products found
because this supplier's products are not listed.
René Platzer, et al.,
bioRxiv - Immunology 2023
Quote:
... As setup #2 we operated an Eclipse Ti-E (Nikon) inverted microscope system that was equipped with a 100x objective (Nikon SR APO TIRF 100x ...
-
No products found
because this supplier's products are not listed.
Mohammad S. E. Sendi, et al.,
bioRxiv - Neuroscience 2024
Quote:
... we used one adult male Sprague-Dawley rat (2– 3-month-old; 250–300 g) from Charles River Laboratories (Wilmington ...
-
No products found
because this supplier's products are not listed.
Analía Lima, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and STD samples were mixed and the rehydration solution (7 M urea, 2 M thiourea, 4% CHAPS, 0.5% IPG Buffer 4-7 [GE Healthcare]) was added before overnight IPG-strips passive rehydration (pH gradient 4-7 ...
-
No products found
because this supplier's products are not listed.
Alexander M. Horspool, et al.,
bioRxiv - Microbiology 2021
Quote:
... Male and female (Figures 2-3) or male (Figures 4-7) eight-week-old B6.Cg-Tg(K18-hACE2)2Prlmn/J mice (Jackson Laboratory 034860) were anesthetized with a single intraperitoneal dose of ketamine (Patterson Veterinary 07-803-6637 ...
-
No products found
because this supplier's products are not listed.
Rebecca Halbach, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... fully 2’O-methylated antisense RNA oligonucleotide with a FemtoJet 4x (Eppendorf) with 1200 hPa pressure ...
-
No products found
because this supplier's products are not listed.
Celia Barrio-Alonso, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... for 5-7 days and embedded into 2 mg/ml collagen type-I (StemCell Technologies, Vancouver, Canada) gels ...
-
No products found
because this supplier's products are not listed.
Masahito Yamagata, Wenjun Yan, Joshua R. Sanes,
bioRxiv - Neuroscience 2020
Quote:
... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Ke Xu, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... rabbit anti-B-cell lymphoma-2 (BCL-2) polyclonal antibody (1:1,000 dilution, 26593-1-AP, Proteintech, Rosemont, IL, USA) and mouse anti-GAPDH monoclonal antibody (1:10,000 dilution ...
-
No products found
because this supplier's products are not listed.
Pranay Ramteke, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Safranin-O staining was visualized using an Axio Imager 2 microscope (Carl Zeiss, Germany) using 5×/0.15 N-Achroplan or 20×/0.5 EC Plan-Neofluar objectives and Zen2TM software (Carl Zeiss).
-
No products found
because this supplier's products are not listed.
Masaharu Somiya, Shun’ichi Kuroda,
bioRxiv - Cell Biology 2021
Quote:
... Synergy 2 (BioTek).
-
No products found
because this supplier's products are not listed.
Zac Chatterton, et al.,
bioRxiv - Genomics 2022
Quote:
... 0.25 μL of Proteinase K (Zymo, D3001-2-5), and 2.5μL of H2O ...
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... Cortical layers 2/3 and 4 neurons were visualized by using an upright microscope and camera system (BX51WIF, Olympus, and SciCam Pro CCD camera ...
-
No products found
because this supplier's products are not listed.
Yili Zhang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Intracellular recordings from MNs were made with 10-20 MΩ sharp electrodes filled with 3 M potassium acetate connected to an Axoclamp 2-B amplifier (Molecular Devices). Data acquisition and analyses of resting potential ...
-
No products found
because this supplier's products are not listed.
Dessislava Malinova, et al.,
bioRxiv - Immunology 2020
Quote:
... for mouse splenic B cells and goat F(ab’)2 anti-human Fc5μ (Jackson Immunoresearch) for Ramos and DG75 cells ...