-
No products found
because this supplier's products are not listed.
Tasneem Qaqorh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... diluted with 0.001% Poloxamer 188 (Sigma) in PBS targeting mouse Atf3 (pAAV[2miR30]-cTnT>sfGFP:{GAGCCTGGTGTTGTGCTATTTA}:{GAGATTCGCCATCCAGAATAAA} ...
-
No products found
because this supplier's products are not listed.
Sophie Robinson, et al.,
bioRxiv - Neuroscience 2024
Quote:
... A diafiltration step was then performed to concentrate the purified AAVs and reformulate them into PBS + 0.005% poloxamer 188 (# 13-901-CI, Corning) using Amicon Ultra-4 filter units (# UFC8100 ...
-
No products found
because this supplier's products are not listed.
Henning Peter Düsedau, et al.,
bioRxiv - Immunology 2021
Quote:
... MAP2 (2 µg/µl, #188 011, Synaptic Systems), and NeuN (dilution 1:2000 ...
-
No products found
because this supplier's products are not listed.
Shayna Thomas-Jardin, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... (Fisher Scientific, 50-188-2396)) beginning on Day 7 and continuing for the duration of the experiment ...
-
No products found
because this supplier's products are not listed.
Mayur Bajaj, Annapurna Devi Allu, Basuthkar J Rao,
bioRxiv - Plant Biology 2023
Quote:
... 200-300µl of 1x RIPA lysis buffer (Merck; 20-188) containing 10% glycerol ...
-
No products found
because this supplier's products are not listed.
Noelle V. Antao, et al.,
bioRxiv - Cell Biology 2023
Quote:
Fetal Bovine Serum (VWR 89510-188)
-
No products found
because this supplier's products are not listed.
Mohammed Samer Shaban, et al.,
bioRxiv - Immunology 2020
Quote:
... anti ATF3 (Santa Cruz, #sc-188), anti HERPUD1 antibody (Abnova ...
-
No products found
because this supplier's products are not listed.
Gong Chen, et al.,
bioRxiv - Neuroscience 2020
Quote:
... All AAV used in this study was prepared in 0.001% Pluronic F-68 solution (Poloxamer 188 Solution, PFL01-100ML, Caisson Laboratories, Smithfield, UT, USA). Retroviral vector CAG::NeuroD1-IRES-GFP were constructed ...
-
No products found
because this supplier's products are not listed.
Seydou Keita, et al.,
bioRxiv - Immunology 2022
Quote:
... CD56 PC7 (Biolegend, clone MEM-188), CD14 PE-CF594 (BD Bioscience ...
-
No products found
because this supplier's products are not listed.
William Mouton, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Cells were cultured in 75 cm2 flasks (T75, Corning Inc. BD Falcon, Corning, NY, USA) at 37°C under 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Kati J. Ernst, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... in a 50 ml tube (Corning 352070) (when having a frozen cell pellet as starting material, 3 ml of washing buffer and 15 ml tubes [Greiner Bio-One 188-271] were used). The debris and leaking RNA were removed by centrifugation (500 g ...
-
No products found
because this supplier's products are not listed.
Frederik Nørby Friis Sørensen, et al.,
bioRxiv - Neuroscience 2024
Quote:
... IgG1 κ Isotype (1:188, STEMCELL Technologies, 60070AD.1, 0.2 ug/µL) was used ...
-
No products found
because this supplier's products are not listed.
Kate Hawkins, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 10 ng/mL FGF (Peprotech, 100-188) and 1 mg/mL laminin (Sigma ...
-
Cat# HY-D1005-500 mg,
500 mg, USD $50.0
Ask
Haoran Mu, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Adenine (188 μmol/L, #HY-B0152, MedChemExpress), ALK inhibitor A 83-01 (0.5 μmol/L ...
-
No products found
because this supplier's products are not listed.
Luz E. Cabrera, et al.,
bioRxiv - Immunology 2024
Quote:
... CD56 FITC (clone MEM-188, catalog #: 21270563) from ImmunoTools; CD19 FITC (clone HIB19 ...
-
No products found
because this supplier's products are not listed.
Veronique Fischer, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Total RNA was extracted following TRI® Reagent (Molecular Research Center Inc., Cat# TR 188) manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Joseph Hanna, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... 354210)/Laminin (Corning, 354232) (2.5 μg/mL) (Sarstedt, Germany). Cells were cultured for 5 days then transferred to Seahorse 96-well plate at a density of 40,000/well ...
-
No products found
because this supplier's products are not listed.
Virender Kumar Sharma, Mayurika Lahiri,
bioRxiv - Molecular Biology 2020
Quote:
... The cells were maintained in 100 mm dishes (Eppendorf or Corning) and were grown in high glucose Dulbecco’s Modified Eagle Medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Tania Hübscher, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... and plated in 24-well plates (Corning, Catalog No. 353047, or Ibidi, Catalog No. 82426). After Matrigel polymerization ...
-
No products found
because this supplier's products are not listed.
Yasuko Tobari, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... and 188 mg/mL 5-bromo-4-chloro-3-indolyl phosphate (Roche Diagnostics) in a solution of 0.1 M Tris (pH 9.5) ...
-
No products found
because this supplier's products are not listed.
Deepthi Ashok, et al.,
bioRxiv - Pathology 2024
Quote:
... Cardiomyocytes were purified using a PSC-Derived Cardiomyocyte Isolation Kit (130-110-188, Miltenyi Biotec). LS columns were used to enrich cardiomyocytes (130-042-401 ...
-
This antibody is a rat monoclonal antibody that binds specifically to mouse B7-H4, and it can...
Cat# NEUT-2275CQ,
Inquiry
Ask
Haizhang Chen, et al.,
bioRxiv - Immunology 2020
Quote:
... Recombinant CD20 was obtained as a peptide (aa141-188) containing the binding region of rituximab (Creative Biolabs). FcγR-specific mAbs were obtained from Stem Cell technologies (CD16 ...
-
No products found
because this supplier's products are not listed.
Yuwen Zhao, et al.,
bioRxiv - Bioengineering 2022
Quote:
... hMSCs were treated with 20 μM γ-secretase inhibitor DAPT or 20 μM Jag1 peptide (AnaSpec, 188-204) after osteogenic induction ...
-
No products found
because this supplier's products are not listed.
Erica Dhuey, et al.,
bioRxiv - Immunology 2022
Quote:
Mice were injected subcutaneously with a total volume of 200ul containing 100ug TRP2180-188 peptide and 50ug poly(I:C) (InvivoGen) formulated in in PBS ...
-
No products found
because this supplier's products are not listed.
Guiping Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... murine RNAase inhibitor and 1 mg/ml yeast tRNA) and incubated with primary antibodies (Synaptic systems, 188 011, 314 006, 135 304, 106003, 131 005; Abcam, ab5392) in blocking buffer for 1 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Manindra Nath Tiwari, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Neurons on Corning glass coverslips (Thomas Scientific #354086) were transferred to a RC-26GLP recording chamber (Warner Instruments #64-0236 ...
-
No products found
because this supplier's products are not listed.
Jérôme Clatot, et al.,
bioRxiv - Genetics 2022
Quote:
... Patch pipettes (Corning Kovar Sealing code 7052, WPI) had resistances of 1.5-2.5 MΩ when filled with intracellular solution ...
-
No products found
because this supplier's products are not listed.
Olivia Pigden, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... washing with phosphate buffered saline (PBS) (Corning/Lonza). Cells were incubated at 37 °C with 5% CO2.
-
No products found
because this supplier's products are not listed.
Volha Liaudanskaya, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 100µL of collagen type I solution (Corning or R&D systems, 3 mg/mL with a pH adjusted to 7.0-7.2 with NaOH ...
-
No products found
because this supplier's products are not listed.
Andrea Toth, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 60 μL of organoid digest buffer (Dispase [Corning, 354235, undiluted, 50 U/mL], DNase I [GoldBio, D-301 ...
-
No products found
because this supplier's products are not listed.
Sonia Donzelli Dr, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The plate was sealed with Corning microplate tape and transferred to a Fluostar Optima microplate reader (BMG LABTECH), where continuous orbital shaking at 900 rpm and a temperature of 37°C were maintained for the duration of the experiment ...
-
No products found
because this supplier's products are not listed.
Sahar F. Bannoura, et al.,
bioRxiv - Cancer Biology 2023
Quote:
A single suspension containing 1000 cells per 100 μL was plated in 96-well ultra-low attachment plates (corning) in 3D tumorsphere media XF (PromoCell). Media was added to the well every 3 days and growth was monitored microscopically ...
-
No products found
because this supplier's products are not listed.
Dario De Felice, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... cell pellet resuspended in 80% growth factor-reduced basement matrix (either Matrigel®, Corning, 356231; or BME-2®, AMSBIO, 3533) and seeded at the concentration of approximately 50,000 cells/mL by depositing at least six 40 μL drops at the bottom of a non-tissue culture treated plate ...
-
No products found
because this supplier's products are not listed.
Sylvan C. Baca, et al.,
bioRxiv - Cancer Biology 2020
Quote:
For WCM154 Western blots, cell pellets were lysed in RIPA buffer (MilliporeSigma, 20-188) supplemented with Protease/Phosphatase Inhibitor Cocktail (Cell Signaling Technology, 5872S). Protein concentrations were assayed with a Pierce BCA Protein Assay Kit (Thermo Fisher Scientific ...
-
No products found
Melissa A Marchal, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... rat tail collagen I (Corning & Advanced Biomatrix), imatinib (Cayman Chemical) ...
-
No products found
because this supplier's products are not listed.
Nobuyuki Nosaka, et al.,
bioRxiv - Immunology 2024
Quote:
... Corning supplemented with 1% of Penicillin-Streptomycin Solution, 30-0002-CL, Corning; 2% of Fetal Bovine Serum, FB-02, Omega Scientific; and 1% of MEM Non-essential Amino Acid Solution ...
-
No products found
because this supplier's products are not listed.
Alpha A. Lee, et al.,
bioRxiv - Microbiology 2024
Quote:
HeLa-ACE2 cells (BPS Bioscience, were maintained in DMEM (Corning) supplemented with 10% FBS ...
-
No products found
because this supplier's products are not listed.
Petronella R. Hove, et al.,
bioRxiv - Microbiology 2020
Quote:
... with a pH meter (Corning Pinnacle 530, Cole-Parmer, Vernon Hills, IL). All titrated supernatant was filtered through a 0.22 μM-pore filter (Pall Corporation LifeSciences ...
-
No products found
because this supplier's products are not listed.
Constantinos Patinios, et al.,
bioRxiv - Synthetic Biology 2024
Quote:
... supplemented with 10% (v/v) fetal bovine serum (Corning and BANF Biotrend), 1x penicillin streptomycin (Life Technologies ...
-
No products found
because this supplier's products are not listed.
Justin Waletich, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... and placed into 4- or 24-well plates (CellTreat # 229103 and Corning # 07-200-84). Animals were fed small or mashed artemia (SEP-ART GSL ...
-
No products found
because this supplier's products are not listed.
Reza Mirzaei, et al.,
bioRxiv - Immunology 2023
Quote:
... 293FT cells were grown to ∼90% confluency in Corning Hyperflasks and co-transfected with 129 μg of pHELPER (Agilent), 238 μg of Rep-Cap plasmid encoding MG1.2 ...
-
No products found
because this supplier's products are not listed.
C. Denise Okafor, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... clear bottom 96-well plates in phenol red-free MEMα + 10 % fetal bovine serum – Charcoal/Dextran Treated (Corning; Atlanta Biologicals). At 70-90 % confluence ...
-
No products found
because this supplier's products are not listed.
Aleksandr Ianevski, et al.,
bioRxiv - Systems Biology 2020
Quote:
... the compounds were dissolved in 100% DMSO or an aqueous solution and dispensed on tissue culture grade Corning V-bottom 96-well plates using an Echo 550 Liquid Handler (Labcyte) in 4 concentrations of 10-fold dilution series around the IC50 (Suppl ...
-
No products found
because this supplier's products are not listed.
Alessandra Gallo, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Autophagy activation was detected using this specific kit based on a fluorescent amphipathic cationic tracer able to specifically detect the number of intracellular autophagosomes and not in the lysosomes. Cells (approx. 1×104 cells per well) were plated in a 96-wells plate (Corning-Costar, EuroClone) and treated with the C ...
-
No products found
because this supplier's products are not listed.
Haruki Hasegawa,
bioRxiv - Cell Biology 2024
Quote:
... The cells were grown in vented cap Corning® Erlenmeyer flasks placed on Innova 2100 shaker platforms (New Brunswick Scientific) rotating at 130L135 rpm ...
-
No products found
because this supplier's products are not listed.
Liang Ma, Jasleen Singh, Randy Schekman,
bioRxiv - Cell Biology 2023
Quote:
Cells were cultured on 12mm round coverslips (corning) and were fixed with 4% EM-grade paraformaldehyde (Electron Microscopy Science, Hatfield, PA) in PBS pH7.4 for 10 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Priyanka Verma, et al.,
bioRxiv - Cancer Biology 2020
Quote:
1000 cells in a volume of 100 µl were plated into each well of a 96-well clear bottom black plates (Corning, Neta Scientific 3904) on Day 0 ...
-
No products found
because this supplier's products are not listed.
Ved Mehta, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Precipitated sodium deoxycholate was removed by filtering through a Corning® 2 µM PVDF plate and samples were further desalted on a 96-well MacroSpin plate (The Nest Group). Peptides were eluted with 80% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Hannah Drew Rickner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... on Corning® Matrigel® coated tissue culture treated plates and transduced with a NEUROG2 lentivirus (GeneCopoeia cat#LPP-T7381-Lv105-A00-S) at MOI 3 to induce iPSC derived neuronal cells (hiNC) ...
-
No products found
because this supplier's products are not listed.
Kimberly A. Wemmer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... transferred to a Corning 250 mL centrifuge tube (430776) and then spun again at ∼1000xg (2000rpm in a Beckman Coulter Allegra 6 with a GH3.8 rotor) for 10min at RT with no brake ...