-
No products found
because this supplier's products are not listed.
Anastasiia Stratiievska, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Individual intracellular calcium levels of MEG-01 cells were recorded using an inverted XI81F-3 microscope (Olympus, equipped with a motorized stage (MS-2000 ...
-
No products found
because this supplier's products are not listed.
Senthil T. Kumar, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 5 mg of 1,2-fioleoyl-sn-glycero-3-phosphoethanolamine (DOPE):1,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS):1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) 5:3:2 w/w (Avanti Polar Lipids) were resuspended in 0.8 mL methanol:chloroform 1:1 ...
-
No products found
because this supplier's products are not listed.
Nicole A. Jandick, Cathy L. Miller,
bioRxiv - Microbiology 2023
Quote:
... Membranes were washed with 1x TBST 3 times and incubated for 5 minutes 3 times between antibody incubations and before addition of NovaLume Atto Chemiluminescent Substrate AP (Novus Biologicals). Membranes were then imaged on a ChemiDoc SRS Imaging System (Bio-Rad Laboratories ...
-
No products found
because this supplier's products are not listed.
Alexander P. Clark, et al.,
bioRxiv - Bioengineering 2021
Quote:
Human embryonic kidney cells 293 stably expressing human hyperpolarization-gated cyclic nucleotide-sensitive cation channel 1 (HEK-HCN1) were obtained from Charles River (CT6114). Cells were cultured and maintained according to the online protocol by Charles River ...
-
No products found
because this supplier's products are not listed.
Neha, Prashant Ranjan, Parimal Das,
bioRxiv - Cancer Biology 2023
Quote:
... Ca2+ dependent fluorescence intensity of Fluo-3/AM was measured by flow cytometry (CytoFLEX LX Beckman Coulter).
-
No products found
because this supplier's products are not listed.
Chahrazade Kantari-Mimoun, et al.,
bioRxiv - Immunology 2020
Quote:
... a cyclic immunofluorescence device developed by Miltenyi Biotec (publication in preparation). The three displayed images of EpCAM-APC ...
-
No products found
because this supplier's products are not listed.
Nina R. Montoya, et al.,
bioRxiv - Microbiology 2022
Quote:
... The plates were developed with TMB (3, 3’, 5, 5’ - Tetramethylbenzidine) ELISA Peroxidase Substrate (Rockland Immunochemical, Limerick, PA), and absorbance was measured on a plate reader at 655 nm.
-
No products found
because this supplier's products are not listed.
Anna L. Vlasits, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Boroscillate pipettes (Sutter Instruments, 3-5 MΩ) were used for all recordings and whole-cell electrophysiology recordings were performed using a Multiclamp 700B amplifier (Molecular devices) ...
-
No products found
because this supplier's products are not listed.
Yuan Yue, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... 3 μg DNMT3B antibody (GeneTex) or mouse IgG (MilliporeSigma ...
-
No products found
because this supplier's products are not listed.
Emma T Crooks, et al.,
bioRxiv - Immunology 2021
Quote:
... cells were resuspended in calcium-containing HBSS and incubated at room temperature for 5 minutes before activation by anti-IgM F(ab′)2 (Southern Biotech) or VLPs ...
-
No products found
because this supplier's products are not listed.
Benjamin N. Bell, et al.,
bioRxiv - Immunology 2021
Quote:
RBD antigen binding during selection rounds 3 and 5 was evaluated using a 1:1000 dilution of rabbit anti-His FITC secondary antibody (Bethyl Laboratories). RBD antigen binding during selection Round 4 was evaluated using a 1:1000 dilution of Streptavidin-Alexa Fluor 647 secondary (Jackson ImmunoResearch) ...
-
No products found
because this supplier's products are not listed.
Roger S. Zou, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3 μL of antibody per IP (Cas9 – Diagenode C15310258 ...
-
No products found
because this supplier's products are not listed.
Kristen L. Wells, et al.,
bioRxiv - Immunology 2020
Quote:
... Anti-RANKL antibody (Clone IK22/5, BioXCell) or isotype control antibody (clone 2A3 ...
-
No products found
because this supplier's products are not listed.
I.R. Akberdin, et al.,
bioRxiv - Systems Biology 2021
Quote:
... Another target of calmodulin is Ca2+/calmodulin-dependent protein kinase kinase 2 (CAMKK2) that phosphorylates AMPK Thr172 thereby activating the kinase (Abbott et al., 2009). In turn ...
-
No products found
because this supplier's products are not listed.
T Krischuns, et al.,
bioRxiv - Microbiology 2023
Quote:
... and 5’-mono-phosphorylated v51_mut_S templates were specifically digested with a terminator 5’-phosphate-dependent exonuclease (Biosearch technologies) and subjected again to the Monarch RNA Cleanup Kit (NEB) ...
-
No products found
because this supplier's products are not listed.
Juncai Ma, et al.,
bioRxiv - Plant Biology 2020
Quote:
... voltage-dependent anion channel 1 (VDAC1; Agrisera), peripheral-type benzodiazepine receptor (PBR ...
-
No products found
because this supplier's products are not listed.
X. Rosa Ma, et al.,
bioRxiv - Neuroscience 2021
Quote:
... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
No products found
because this supplier's products are not listed.
Qiongxuan Lu, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Calcium imaging was performed on an inverted microscope (Nikon) with a 40x lens ...
-
No products found
because this supplier's products are not listed.
Claudia Matthaeus, et al.,
bioRxiv - Cell Biology 2022
Quote:
Calcium transients of cultured embryonic cardiomyocytes at DIV4-5 were measured after incubating myocytes with the calcium-sensitive fluorescence dye Fura2-AM (1 μM, Biotium, Cat: 50033-1) diluted in 0.02% Pluronic acid F-127/DMSO (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Kamal Mandal, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 5 mg of C18 solid phase (3 μm, Durashell, Phenomenex). The HpHt column was sequentially washed with a series of 3 different solvents/solutions namely methanol ...
-
No products found
because this supplier's products are not listed.
Aniruddha Das, et al.,
bioRxiv - Neuroscience 2022
Quote:
... A 3×5 mm2 craniotomy was drilled (Omnidrill35, World Precision Instruments) over an area covering the monocular and binocular primary visual (V1m and V1b ...
-
No products found
because this supplier's products are not listed.
Dorota M. Krzyżanowska, et al.,
bioRxiv - Microbiology 2022
Quote:
... Experiments requiring cultivation of P482 in the presence of root exudates were performed in a single carbon source medium (1C medium) comprising: basic M9 salts (MP Biomedicals), 10 mM of Mg2SO4 ...
-
No products found
because this supplier's products are not listed.
Chen Qian, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The UGT2B15 promoter 20 base-pair sequence (5’-TAACTTGATTGATTTTTCCT-3’ for wild type and 5’-TAACTTGGCTGTCTTTTCCT-3’ for mutant) was immobilized to a streptavidin SADH sensor chip (Sartorius) in running buffer (10 mM HEPES pH 6.8 ...
-
No products found
because this supplier's products are not listed.
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Addgene)[70] in a ratio of 5:3:2 using polyethylenimine (24765-2, Polysciences). Virus supernatant was harvested 30 h after transfection ...
-
No products found
because this supplier's products are not listed.
Yue Li, et al.,
bioRxiv - Genomics 2021
Quote:
... All cells were thoroughly rinsed in Hank’s balanced salt solution without calcium and magnesium (EMS) before fixation with EM fixative ...
-
No products found
because this supplier's products are not listed.
Zhong Yan Gan, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The nucleotide-free or nucleotide-bound dodecamers were dispensed onto glow discharged UltrAuFoil (Quantifoil GmbH, Germany) R1.2/1.3 holey specimen support (‘grid’ ...
-
No products found
because this supplier's products are not listed.
Jennifer Hirst, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Dried peptides were suspended in 5% (v/v) formic acid and analysed in data-dependent acquisition (DDA) mode on a TripleTOF 5600 mass spectrometer (SCIEX) in-line with a nanoflow electrospray ion source and nano-HPLC system ...
-
No products found
because this supplier's products are not listed.
Tan Jimin, et al.,
bioRxiv - Microbiology 2020
Quote:
... RIC8A guanine nucleotide exchange factor A (RIC8A) (ABclonal), Annexin 4 (ANXA4 ...
-
No products found
because this supplier's products are not listed.
Melody Li, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Patch pipettes of 3-5 MΩ (Harvard Apparatus) were made using a puller (P-1000 ...
-
No products found
because this supplier's products are not listed.
Cynthia M. Arokiaraj, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Cyanine 3 and Cyanine 5 reagents from Akoya Biosciences were used for probe visualization.
-
No products found
because this supplier's products are not listed.
Yuta Kudo, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Methyl 3-oxoheptanoate (TCI America, 790 mg, 5 mmol) was dissolved in 6 mL of aqueous 3.0 M NaOH and 300 μL of tetrahydrofuran ...
-
No products found
because this supplier's products are not listed.
Patrik T. Simmler, et al.,
bioRxiv - Cell Biology 2021
Quote:
... SF3B1 antibody from MBL International (D221-3), an HIF1β antibody from Novus Biological (NB 100-124) ...
-
No products found
because this supplier's products are not listed.
Elizabeth R. Sharlow, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 7753 NPCs (1×105) were seeded onto cyclic olefin co-polymer coverslips (ibidi GmbH, Munich, Germany) that were cut into 2.5 cm diameter circles and coated with 50 μg/mL poly-L-ornithine and 25 μg/mL laminin ...
-
No products found
because this supplier's products are not listed.
Iris E. Glykofridis, et al.,
bioRxiv - Genetics 2022
Quote:
... Ab #3 (1:1000 in BSA, HPA028760, Atlas antibodies) and Ab #4 (1:1000 in BSA ...
-
No products found
because this supplier's products are not listed.
Joel Johnson George, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... X-gal (5-Bromo-4-chloro-3-indoxyl-beta-D-galactopyranoside, Goldbio) was dissolved in dimethylformamide at 50 mg/ml ...
-
No products found
because this supplier's products are not listed.
Angus B. Thies, et al.,
bioRxiv - Physiology 2021
Quote:
... Slides were again washed PBS-TX to remove unbound secondary antibody (3 x 5 min) and samples were imaged using a fluorescence microscope (Zeiss AxioObserver, Carl Zeiss AG, Oberkochen, Germany).
-
No products found
because this supplier's products are not listed.
Nicholas A. Pudlo, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5 mice were switched to a diet containing 3% Porphyrayezoensis (TD.190608, Envigo), which was ground into a course powder and added to TD.190608 to replace 3% of the dextrose contained in the base diet ...
-
No products found
because this supplier's products are not listed.
Patrick Marsall, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 µg/mL R-phycoerythrin-labeled goat anti-human IgG antibody (109-116-098, Dianova) diluted in assay buffer was added to each well and incubated for 45 mins ...
-
No products found
because this supplier's products are not listed.
Yousef M. Alhammad, et al.,
bioRxiv - Microbiology 2023
Quote:
... Primary antibody incubation was conducted for 3 hours at room temperature (1:2,000 α-N protein, Sino Biological 40143-R001 ...
-
No products found
because this supplier's products are not listed.
Chance J. Cosgriff, et al.,
bioRxiv - Microbiology 2019
Quote:
... Donor strains were grown overnight in 3 mL of TSB/LB (1:1) supplemented with 5 mM calcium chloride (CaCl2) (Amresco) and 5 mM magnesium sulfate (MgSO4 ...
-
No products found
because this supplier's products are not listed.
Jordan Demone, et al.,
bioRxiv - Bioengineering 2021
Quote:
... titration curves of conformation-dependent monoclonal IgM (Absolute Antibody, Ab01680-15.0), IgA (Absolute Antibody ...
-
Calcium L-5-methyltetrahydrofolate (L-5-MTHF-Ca) is a synthetic derivative of folic acid, the...
Cat# S5264, SKU# S5264-25mg,
25mg, $97.00
Ask
Masayoshi Nagai, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 1 mM dibutyryl cyclic AMP (Selleck Chemicals S7858) and 2 ng/ml Recombinant Human GDNF (Peprotech 450-10).
-
Cat# HY-P1874,
inquire
Ask
Shuangshuo Jia, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and the autophagy inhibitor 3-methyladenine (3-MA; 5 mM; MedChemExpress) were applied to validate their respective effects.
-
No products found
because this supplier's products are not listed.
S. Kragness, et al.,
bioRxiv - Neuroscience 2022
Quote:
... in Hibernate without Calcium (BrainBits) and 0.1% DNase at 37°C for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Michelle Wantoch, et al.,
bioRxiv - Immunology 2020
Quote:
... 96 well plates were coated with a mixture of antibodies against IFN-α (Mabtech, MT1/3/5) overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Alina Sultanova, et al.,
bioRxiv - Immunology 2020
Quote:
... 3 and 5 were obtained from Abnova (Taipei, Taiwan). The proteins were produced in vitro using wheat germ expression system which preserves native protein folding.
-
No products found
because this supplier's products are not listed.
S. Bayraktar, et al.,
bioRxiv - Cell Biology 2019
Quote:
Co-immunoprecipitation (CoIP) experiments were performed to detect interaction of GFP-INF2 with calmodulin using the GFP-Trap® affinity resin (Chromotek). All steps were carried out on ice with centrifugations at 4°C ...
-
No products found
because this supplier's products are not listed.
Lauren Rice, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... 5% (v/v) (3-Aminopropyl) triethoxysilane (APTES) (98%, Alfa Aesar, USA) was added to coverslips in Milli-Q water and incubated for 15 min ...
-
No products found
because this supplier's products are not listed.
Adeel Ahmed, et al.,
bioRxiv - Bioengineering 2020
Quote:
... ports 3 and 5 were sealed using adhesive tape (Scotch brand, 3M, USA), and a second collagen solution (COL1 ...
-
No products found
because this supplier's products are not listed.
Evgeny Ivashkin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Samples were incubated in polyclonal rabbit anti-5-HT antibody (ImmunoStar, Hudson ...