-
No products found
because this supplier's products are not listed.
Mark Borris D. Aldonza, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and FUT8 (ab191571, Abcam).
-
No products found
because this supplier's products are not listed.
Kero Guynes, et al.,
bioRxiv - Genomics 2024
Quote:
... Samples were incubated with primary antibodies (mouse anti-acetyl-alpha tubulin antibody, clone 6-11B-1 [Millipore-Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Paulina Sosicka, et al.,
bioRxiv - Biochemistry 2021
Quote:
... FUT8 deficiency was confirmed in Western Blot using a Fut8-specific antibody (Proteintech). The glycosylation defect was confirmed with LCA and AAL lectins (Vector Laboratories) ...
-
No products found
because this supplier's products are not listed.
Aaron Gupta, et al.,
bioRxiv - Immunology 2023
Quote:
Recombinant antibodies were generated using the Expi293 or Expi293 FUT8−/- system (ThermoFisher) using previously described protocols (60) ...
-
No products found
because this supplier's products are not listed.
Tatsuki Isogai, et al.,
bioRxiv - Cell Biology 2024
Quote:
... rabbit polyclonal anti-integrin alpha 6 (1:500, Cell Signaling, Cat# 3750S), rabbit polyclonal anti-integrin alpha 7 (1:500 ...
-
No products found
because this supplier's products are not listed.
Tuancheng Feng, Huan Du, Fenghua Hu,
bioRxiv - Neuroscience 2023
Quote:
... mouse anti-acetylated alpha Tubulin Antibody (6-11B-1) (Santa Cruz, sc-23950), mouse anti-acetylated Tubulin (Lys40 ...
-
No products found
because this supplier's products are not listed.
Shan Li, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Antibodies used for FACS: Human/mouse/bovine integrin alpha 6/CD49f PE-conjugated antibody (FAB13501P, R&D Systems); PE/Cyanine 7 anti-mouse CD325 (Ep-CAM ...
-
No products found
because this supplier's products are not listed.
Ksenija Radic Shechter, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... The following antibodies were used for the 3D cultures: alpha-6-integrin (BD Biosciences 25-0495-82, diluted 1:80), ZO-1 (Invitrogen 61-7300 ...
-
No products found
because this supplier's products are not listed.
Chiara Marullo, et al.,
bioRxiv - Cell Biology 2024
Quote:
Primary antibodies: alpha-tubulin (1:6000, Merck, cat. T9026); GFP (1:3000 ...
-
No products found
because this supplier's products are not listed.
Fadi Saadeh, et al.,
bioRxiv - Neuroscience 2021
Quote:
Rabbit Pdgfr-alpha monoclonal antibody (Novus Biologicals Cat. JF104-6)
-
No products found
because this supplier's products are not listed.
Kerry L. Hilligan, et al.,
bioRxiv - Immunology 2021
Quote:
... Anti-IL-6 (MP5-20F3) and anti-TNF-alpha (MP6-XT22) were from BioLegend.
-
No products found
because this supplier's products are not listed.
Thordis Kristjansdottir, et al.,
bioRxiv - Systems Biology 2021
Quote:
... coli (NEB 5-alpha) and plated on L-medium [27] with 100 µg/mL ampicillin ...
-
No products found
because this supplier's products are not listed.
Thomas Tischer, Jing Yang, David Barford,
bioRxiv - Cell Biology 2020
Quote:
... the process was repeated with an alpha-tubulin antibody (BioRad MCA78G, 1:2000) to minimize cross-reaction ...
-
No products found
because this supplier's products are not listed.
Paulina Sosicka, et al.,
bioRxiv - Biochemistry 2021
Quote:
The guide RNA sequence CAGAATTGGCGCTATGCTAC targeting exon 7 of FUT8 was cloned into px458 pSpCas9(BB)-2A-GFP (Addgene). The resulting plasmid was transfected into Huh7 cells using ViaFect (Promega ...
-
No products found
because this supplier's products are not listed.
Stoyan Petkov, et al.,
bioRxiv - Bioengineering 2020
Quote:
... or anti-alpha Fetoprotein (AFP) (DAKO, Cat. # A0008; 1:300). Cardiomyocytes were immunostained with anti-α-Actinin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Kirill Gorshkov, et al.,
bioRxiv - Microbiology 2020
Quote:
... and acceptor antibodies were conjugated to Alpha Acceptor Beads (PerkinElmer #6760137M).
-
No products found
because this supplier's products are not listed.
Zhang Yichan, et al.,
bioRxiv - Microbiology 2024
Quote:
... The following capture antibodies were used: IL-6 (Monoclonal Antibody, PeproTech® ...
-
No products found
because this supplier's products are not listed.
Ana Luisa Dian, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... anti-alpha Tubulin antibody (GeneTex, # GTX628802; 1:1000 dilution), anti-HSC70 antibody (Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Gerard Cantero-Recasens, et al.,
bioRxiv - Cell Biology 2021
Quote:
... FUT8-KD and FUT8 overexpressing (FUT8 OV) cells were lysed and total RNA extracted with the RNeasy extraction kit (Qiagen, Netherlands). cDNA was synthesized with Superscript III (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Apurva T. Prabhakar, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... CKII alpha’ Antibody 1:1000 (Bethyl; catalog no. A300-199A).
-
No products found
because this supplier's products are not listed.
Mark Borris D. Aldonza, et al.,
bioRxiv - Cancer Biology 2021
Quote:
GDP-Fuc activity of FUT8 was assayed using GDP-Glo glycosyltransferase assay kit (Promega) following manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Hae Ryong Kwon, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... in alpha MEM (Corning) plus 10% FBS (mesenchymal stem cell-qualified ...
-
No products found
because this supplier's products are not listed.
Chih-Wei Chu, et al.,
bioRxiv - Immunology 2023
Quote:
Antibody binding was also assayed by flow cytometry using CHO-K1 and CHO-K1 Fut8 KO cells transfected with a human PD-1 plasmid (GenScript) by lipofectamine (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
James T. Van Leuven, et al.,
bioRxiv - Microbiology 2021
Quote:
Signaling by interferon alpha receptor 1 (IFNAR1) was inhibited by treating mice with 0.05 mg anti-IFNAR1 antibody (MAR1-5A3, Bio X Cell) intranasally on days -2 and 0 with virus or mock inoculations ...
-
No products found
because this supplier's products are not listed.
Matthew R. Lanahan, Julie K. Pfeiffer,
bioRxiv - Microbiology 2021
Quote:
... C57BL/6 mice defective for the interferon alpha/beta receptor (IFNAR-/-) were obtained from Jackson Laboratories and all experimental mice were 8-to 12-weeks old ...
-
No products found
because this supplier's products are not listed.
Alexandra Weiss, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Slides were then placed in secondary antibodies, Alpha-Bungarotoxin AF555 1:500 (ThermoFischer, #B35451) and Donkey anti-Rabbit AF488 1:450 (Jackson ImmunoResearch, #711-545-152), diluted in PBS1X for 2.5 hours at room temperature ...
-
No products found
because this supplier's products are not listed.
Fatimah Aljubran, et al.,
bioRxiv - Physiology 2023
Quote:
... DNA Standards 1-6 (KAPA Biosystems KK4903). The RNA-Seq libraries were normalized to a 2nM concentration and pooled for multiplexed sequencing on the NovaSeq 6000.
-
No products found
because this supplier's products are not listed.
Lorena Benedetti, et al.,
bioRxiv - Neuroscience 2024
Quote:
... The following primary antibodies were used: rabbit polyclonal anti-Ca2+ channel P/Q-type alpha-1A antibody (1:400 dilution, Synaptic Systems 152203); rabbit monoclonal anti-phospho-CaMKII (Thr286 ...
-
No products found
because this supplier's products are not listed.
Theodoros Simakou, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 1 μg/mL mouse anti-acetylated alpha-Tubulin (StemCell Technologies, 100-0753), 10 μg/mL rabbit anti-MERTK (Abcam ...
-
No products found
because this supplier's products are not listed.
Melissa Hingorani, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Mouse pups (C57BL/6, Charles River, PD 1-2) were anesthetized on ice ...
-
No products found
because this supplier's products are not listed.
Judit Sastre, et al.,
bioRxiv - Biophysics 2024
Quote:
... retention time = 6 min) The peptide was lyophilized (Christ Freeze Dryer Alpha 2-4 LDplus, VWR) and stored at -20 °C ...
-
No products found
because this supplier's products are not listed.
Allison L. Saettele, et al.,
bioRxiv - Neuroscience 2022
Quote:
... alpha-bungarotoxin (125 μM, Tocris) was injected into the cavity of the heart ...
-
No products found
because this supplier's products are not listed.
Vivian S. Park, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... cis-6-hexadecenoic acid (cis-6-C16:1, Cayman Chemical, Cat# 9001845), cis-7-hexadecenoic acid (cis-7-C16:1 ...
-
No products found
because this supplier's products are not listed.
Marco Tigano, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... TNF-alpha (200 ng ml−1, Invivogen), IFN-beta (5 ng ml−1 ...
-
No products found
because this supplier's products are not listed.
Cristian V. Crisan, et al.,
bioRxiv - Microbiology 2023
Quote:
... and secondary antibodies against rabbit (for Hcp) and mouse (for RNA polymerase subunit alpha) (1:5000, LI-COR Biosciences). The membrane was imaged using a Biorad ChemiDoc imager and analyzed in FIJI.
-
No products found
because this supplier's products are not listed.
Ramona Jühlen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FADS 1 cells were grown in MEM Alpha (Lonza, Basel, Switzerland) supplemented with 15% FBS and 1% pen/strep ...
-
No products found
because this supplier's products are not listed.
Robert Hardt, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-alpha-tubulin (1:2,000, rabbit pAb, 600-401-880, Rockland Immunochemicals, Gilbertsville, PA), and anti-beta-actin (1:5,000 ...
-
No products found
because this supplier's products are not listed.
Thai Le,
bioRxiv - Synthetic Biology 2021
Quote:
... 2021: Escherichia coli DH5 alpha (Takara (Korea)) ...
-
No products found
because this supplier's products are not listed.
Benjamin J. Meckiff, et al.,
bioRxiv - Immunology 2020
Quote:
... Cells were stimulated by the addition of individual virus-specific peptide pools (1 µg/ml) for 6 h in the presence of a blocking CD40 antibody (1 µg/ml; Miltenyi Biotec). For subsequent MACS-based enrichment of CD154+ ...
-
No products found
because this supplier's products are not listed.
BA Killinger, et al.,
bioRxiv - Neuroscience 2020
Quote:
The next day sections were wash 6 × 10 min with wash buffer (1 × TBS, 0.05% triton X-100) and incubated with biotinylated antibody (Vector Laboratories) diluted 1:200 in secondary blocking buffer (1 × TBS pH 7.6 ...
-
No products found
because this supplier's products are not listed.
Joseph K. McKenna, et al.,
bioRxiv - Genetics 2024
Quote:
... without Alpha-Thioglycerol (GE Healthcare Life Sciences Cat. # SH30228.01); 1X GlutaMAX-I ...
-
No products found
because this supplier's products are not listed.
Vargas Alexandra, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and alpha-tubulin (Active Motif, 39527). Horseradish peroxidase-conjugated anti-rabbit or anti-mouse antibodies were from Invitrogen ...
-
No products found
because this supplier's products are not listed.
Musleh M. Muthana, et al.,
bioRxiv - Immunology 2023
Quote:
... Mouse TNF-alpha (Sino Biological Inc, 50349-MNAE). IgE ELISA Kit (Thermo Fisher Scientific/Invitrogen ...
-
No products found
because this supplier's products are not listed.
Wenjing Zhang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... The membranes were then incubated with the following primary antibodies at 4°C for 6 h: GAPDH (1:6000, no. A19056), vinculin (1:1000, A2752) (ABclonal Technology, Co., China), caspase-3 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Daigo Miyazaki, et al.,
bioRxiv - Genetics 2024
Quote:
... mouse anti- alpha-Sarcoglycan (NCL-a-SARC, Leica Biosystems), mouse anti-MYH-1 (6H1 ...
-
No products found
because this supplier's products are not listed.
Diana Arseni, et al.,
bioRxiv - Neuroscience 2024
Quote:
... the grids were incubated with secondary antibodies conjugated to 10 nm or 6 nm gold particles (Cytodiagnostics, 1:20, and Electron Microscopy Sciences, 1:40) in PBS containing 0.1% gelatin at 21 °C for 1 h ...
-
No products found
because this supplier's products are not listed.
Shubham Singh, et al.,
bioRxiv - Biochemistry 2024
Quote:
... in a 6:4:1 ratio using PEI-max (Polysciences #24765-100). Virus-containing medium was harvested two days post-transfection ...
-
No products found
because this supplier's products are not listed.
Tim J. Cooper, et al.,
bioRxiv - Genetics 2021
Quote:
... 6 μL of denatured PhiX control (prepared according to Illumina protocol, final concentration 1%) was added to the library ...
-
No products found
because this supplier's products are not listed.
Nanda Kishore Routhu, et al.,
bioRxiv - Immunology 2020
Quote:
... washed 6 times and then incubated with 1: 6000 dilution of horseradish peroxidase (HRP) conjugated anti-mouse IgG secondary antibody (Southern Biotech; Birmingham, AL, USA) for 1 h at RT ...
-
No products found
because this supplier's products are not listed.
Federico Cocozza, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 10% and 6% and ultracentrifuged at 187,000xg for 1:30h at 4°C in Sw32.1Ti rotor (Beckman Coulter). Afterwards ...