-
Cat# 211750-50-4,
Inquire
Ask
Alexandra Gros, et al.,
bioRxiv - Neuroscience 2023
Quote:
... These rats also received one intraperitoneal injection of 5-Bromo-2’-deoxyuridine (BrdU, 200 mg/kg in 0.9% NaCl, BOC Sciences 59-14-3) 24h before sacrifice to study adult newborn cell proliferation after several days of simulated microgravity exposure and to reduce the number of animals used for this study.
-
No products found
because this supplier's products are not listed.
Dipsikha Biswas, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 0.8 ng/uL in H2O containing sodium-2-Keto-3-methyl-d3-butyrate-3,4,4,4d4 (KIVd7; CDN Isotopes), 120 µl of 6M perchloric acid (VWR ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Hannes Maib, David H. Murray,
bioRxiv - Cell Biology 2021
Quote:
... were produced by mixing 95 mol % 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) with 5 mol % of the respective phosphatidylinositol together with 0.1% Atto647N-DOPE (ATTO-TEC) or Rhodamine-DOPE ...
-
No products found
because this supplier's products are not listed.
Miriam Pagin, et al.,
bioRxiv - Genetics 2021
Quote:
... wild-type and Sox2-deleted neurospheres were grown for 2-3 passages (3-4 days each) in FM supplemented with bFGF (10ng/ml, Tebu-bio) and EGF (10 ng/ml ...
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
Campbell D. Lawson, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 10 nM leptomycin b, vehicle control or library compounds (Supplementary Tables 2, 3) were added using an Echo liquid handler (Labcyte/Beckman Coulter). Cells were incubated for a further 24 h then fixed in 4% paraformaldehyde and stained with DAPI and Alexa Fluor 488 Phalloidin (ThermoFisher) ...
-
No products found
because this supplier's products are not listed.
Ian J. Campbell, et al.,
bioRxiv - Biochemistry 2020
Quote:
... MA) and commercially available screens including Wizard Classic 1 and 2 and Wizard Classic 3 and 4 (Rigaku Reagents, Inc., Bainbridge Island, WA), MORPHEUS and MIDAS (Molecular Dimensions ...
-
No products found
because this supplier's products are not listed.
Joanne Durgan, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and incubated by horizontal shaking (160 rpm) at 37°C in 8% CO2 for 2 days with addition of 5% Feed (Irvine Scientific) after 1 day ...
-
No products found
because this supplier's products are not listed.
Hossein Mohammad-Beigi, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
Sulfo SASD (Sulphosuccinimidyl-2-(p-azidosalicylamido) ethyl-1,3-dithiopropionate) was purchased from G-biosciences. Dibenzocyclooctyne (DBCO)-Sulpho-NHS and DBCO-Sulpho-Cyanine5 were purchased form click chemistry tools and Genabioscience companies ...
-
No products found
because this supplier's products are not listed.
Holly C. Ford, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Cells were harvested 2-3 hours later and lysed using a cell disrupter (Constant Systems Ltd.). Proteins were purified from inclusion bodies using Nickel affinity chromatography on prepacked HisTrap FF columns (Cytiva ...
-
No products found
because this supplier's products are not listed.
Cori K. Cahoon, et al.,
bioRxiv - Developmental Biology 2022
Quote:
The quantification of GFP::SYP-2 and mCherry::SYP-3 was performed using Imaris (Oxford Instruments) in combination with our whole gonad analysis ...
-
No products found
because this supplier's products are not listed.
Estifanos N. Habtemichael, et al.,
bioRxiv - Physiology 2019
Quote:
... 100 μl of resuspended cells and 2-4 μg of desired plasmid DNA in 5 μL of volume were pipetted into electroporation cuvettes (2 mm gap, Bulldog Bio 12358-346) and electroporated using a NEPA21 electroporation system ...
-
No products found
because this supplier's products are not listed.
Timothy A. Troppoli, et al.,
bioRxiv - Neuroscience 2023
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#87900, Point Style 2, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Anicca Harriot, et al.,
bioRxiv - Pathology 2023
Quote:
... Anesthetized mice (2-3% isoflurane) were placed in supine position on the temperature maintained (Deltaphase Isothermal Pad, Braintree Scientific) platform of an Aurora 3100 with the knee stabilized and foot affixed on the footplate of the torque transducer ...
-
No products found
because this supplier's products are not listed.
Mads Kuhlmann Andersen, et al.,
bioRxiv - Physiology 2022
Quote:
... 5 μL of crude homogenate and protein standards (0 to 2 mg mL-1 bovine serum albumin, ALB001.25, Bioshop Canada, Burlington, ON, CA) was loaded into wells in triplicate followed by 250 μL of Bradford reagent (B6916 ...
-
No products found
because this supplier's products are not listed.
AM Raus, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 100μL for anti-H4K8ac (Epicypher, 13-0047, Lot: 20202001-11), and 50μL for anti-IgG control (Rabbit IgG Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Krista L. Newell, et al.,
bioRxiv - Immunology 2021
Quote:
... spike protein probes were added one-by-one to FACS wash buffer (1x PBS, 2% fetal bovine serum) containing 5μM free d-biotin (Avidity, Cat. Bir500A). Both streptavidin-fluor conjugates were used to stain DMSO control samples to further verify the absence of significant frequencies of non-specific streptavidin-binding B cells.
-
No products found
because this supplier's products are not listed.
Pinja Kettunen, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 2 μM Xav939 (BioGems).
-
No products found
because this supplier's products are not listed.
Margot Meyers, et al.,
bioRxiv - Biochemistry 2023
Quote:
... UBE1 (0.2 μL, 5 μM, Boston Biochem. Inc., E-305-025), UBE2D1 (2.6 μL ...
-
No products found
because this supplier's products are not listed.
Christin Herrmann, et al.,
bioRxiv - Microbiology 2020
Quote:
... was added to sample 2 (DUBPAN) and 2 μl of OTUB1 (LifeSensors, Cat#: DB201) was added to sample 3 (DUBK48) ...
-
No products found
because this supplier's products are not listed.
Zhipeng Li, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Solution standard: 2 µl of calibration standard #2 (“CEM2”, LGC Standards #VHG-SM70B-100) was added to 200 µl of 50% HNO3 and heated for 2 hrs at 90°C in a loosely capped 15ml centrifuge tube (VWR ...
-
No products found
because this supplier's products are not listed.
Peter Vandeberg, et al.,
bioRxiv - Immunology 2020
Quote:
Anti-SARS-CoV-2 IgG titers were determined using Human Anti-SARS-CoV-2 Virus Spike 1 (S1) IgG assay (Alpha Diagnostic). hIVIG batches were tested using multiple serial dilutions and a curve constructed by plotting the log of the optical density as a function of the log of the dilution ...
-
No products found
because this supplier's products are not listed.
Amber Gonda, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Samples were lysed and incubated for 5 minutes in Trizol and then 1-bromo-3-chloropropane (BCP) (Molecular Research Center, Inc. Cincinnati, OH) was added to separate the RNA from the remaining material ...
-
Alginate 5% is a viscous alginate hydrogel, suitable for both bioprinting and casting. You can...
Cat# IKA325000503,
5 mL, USD $220.0
Ask
Manabu Shiraishi, Ken Suzuki, Atsushi Yamaguchi,
bioRxiv - Molecular Biology 2022
Quote:
... Cardiac fibroblasts (2 × 104) were plated on a 0.1% gelatin-coated CytoSoft 6-well dish (Advanced Biomatrix) and cultured for 24 hours in DMEM containing 2% FBS ...
-
No products found
because this supplier's products are not listed.
Meghal Desai, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Lysates clarified by centrifugation at 10,000g for 15 minutes at 4°C were incubated with 5ul of serum containing antibodies for 2 hours at 4°C followed by the addition of pre-blocked (with 1% BSA) Protein-A beads (Repligen) for an additional 2 hours ...
-
No products found
because this supplier's products are not listed.
Nadine Kluser, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 1 % Pen/Strep and 5 ng/ml basic fibroblast growth factor (b-FGF, Fitzgerald Industries, Acton, USA) and were seeded in T300 tissue culture flasks (TPP ...
-
No products found
because this supplier's products are not listed.
John Stegmayr, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... A 7000SMZ-2 Vibrotome (Campden Instruments Ltd.) equipped with a temperature controlled tissue bath (Campden Instruments Ltd. ...
-
No products found
because this supplier's products are not listed.
Etienne Becht, et al.,
bioRxiv - Immunology 2020
Quote:
... and 2% Armenian hamster serum (Innovative Research) followed by 15min incubation at 4°C ...
-
No products found
because this supplier's products are not listed.
Yumaine Chong, Ellis Cooper,
bioRxiv - Neuroscience 2022
Quote:
... and rabbit anti-vesicular monoamine transporter 2 (1:1000; Phoenix Pharmaceuticals, Burlingame, CA)] ...
-
No products found
because this supplier's products are not listed.
Gopinath Chattopadhyay, et al.,
bioRxiv - Biophysics 2022
Quote:
... The eluted fractions were pooled and dialysed thrice using a 3-5 kDa (MWCO) dialysis membrane (40mm flat width) (Spectrum Labs) against 1X PBS ...
-
No products found
because this supplier's products are not listed.
Elsio Wunder Jr., et al.,
bioRxiv - Microbiology 2020
Quote:
... coli HY system (5 PRIME) and synthesized crude proteins were printed on 3-pad nitrocellulose-coated AVID slides (Grace Bio-Labs) using a Gene Machine OmniGrid 100 microarray printer (Genomic Solutions) ...
-
No products found
because this supplier's products are not listed.
Andrés López-Perrote, et al.,
bioRxiv - Biophysics 2020
Quote:
... Inputs (2 μl) and elutions (10 μl) samples were analyzed by 4-15% SDS-PAGE (MINI-PROTEAN TGX stain-free, Bio-Rad) and staining with Quick Coomassie (Generon ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Gab-Chol Choi, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and bone morphogenetic protein 2 (BMP-2) (1:200, orb251474, Biorbyt) primary antibodies at 4°C ...
-
No products found
because this supplier's products are not listed.
Kylie M. Konrath, et al.,
bioRxiv - Immunology 2021
Quote:
... and 6μg pNL4-3.luc.R-E- backbone (Aldevron) and incubated for 48 hours ...
-
No products found
because this supplier's products are not listed.
Saurav Kumar, et al.,
bioRxiv - Cell Biology 2023
Quote:
... pMD2.G and psPAX2 in 2:1:2 ratio with PolyJet transfection reagent (SignaGen Laboratories). Media were harvested two days later and added to recipient cells with 1 μg/ml polybrene (Sigma ...
-
No products found
because this supplier's products are not listed.
Sumin Jang, Elias Gunmit, Hynek Wichterle,
bioRxiv - Developmental Biology 2022
Quote:
... ISL1/2 (Goat, 1:5000 Neuromics GT15051), MNX1 (Guinea pig ...
-
No products found
because this supplier's products are not listed.
Gerrald A. Lodewijk, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... cells were seeded at 5,000-10,000 cells per cm2 and passaged every 2-3 days using Accutase (Innovative Cell Technologies, AT104).
-
No products found
because this supplier's products are not listed.
Qiong Wang, et al.,
bioRxiv - Immunology 2019
Quote:
One immunization to induce CIA : Bovine type II collagen (2 mg/ml, Chondrex, cat. # 20021) and complete Freund’s adjuvant (4mg/ml M ...
-
No products found
because this supplier's products are not listed.
Arun Upadhyay, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Stock solutions of recombinant Aβ peptides were prepared by solubilizing lyophilized monomers (Aβ38, rPeptide A-1078-2; Aβ40:rPeptide A-1153-2; and Aβ42: rPeptide A-1163-2) in 1% NH4OH at 200 µM concentration as recommended by manufacturer ...
-
No products found
because this supplier's products are not listed.
Nicole M. Gaudelli, et al.,
bioRxiv - Genomics 2020
Quote:
... and 250IU/mL of recombinant human interleukin-2 (rhIL-2, CellGenix GmbH). Cells were activated with soluble human anti-CD3 (clone OKT3 ...
-
No products found
because this supplier's products are not listed.
Liang Xu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... A hole (2-3 mm diameter) on the skull surface was made by a high-speed microdrill (Microdrill 78001, RWD Life Science) and then covered with a coverslip (Warner ...
-
No products found
because this supplier's products are not listed.
Ian W. McCahill, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 2 media (Caisson Labs). Aqueous solutions of paclobutrazol and GA3 were freshly prepared and diluted to 0.1 µM and 10 µM respectively in hydroponic media ...
-
No products found
because this supplier's products are not listed.
Julia Ledderose, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Time-pregnant female mice were injected intraperitoneally with 50 mg/kg BrdU (5-bromo-2’-deoxyuridine, BrdU; Accurate Chemical & Scientific Corporation) at E11.5 ...
-
No products found
because this supplier's products are not listed.
Anne-Cathrine Vogt, et al.,
bioRxiv - Immunology 2022
Quote:
Recombinant SARS-CoV-2 spike S1 B.1.1.529-Omicron RBD protein was purchased from (antibodies-online GmbH), recombinant SARS-CoV-2 Spike RBD and recombinant SARS-CoV-2 Spike RBD B.1.617.2 L452R T478K were purchased from R&D systems ...
-
No products found
because this supplier's products are not listed.
Tiago Carvalheiro, et al.,
bioRxiv - Immunology 2023
Quote:
... Soluble (s)LAIR-1 (as described previously34) and LAIR-2 (LifeSpan BioSciences) were also measured by ELISA in the serum of HC and SSc patients.
-
No products found
because this supplier's products are not listed.
Fiorella Ghisays, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and 0.5 µg/ml CY-3 (CCCTAA)3 (PNA BIO), denatured at 75°C for 5 minutes and incubated at room temperature for 16hr ...
-
No products found
because this supplier's products are not listed.
Tessa Acar, et al.,
bioRxiv - Plant Biology 2023
Quote:
... fresh explants were soaked in 3 x concentrated MS medium supplemented with 5% (v/v) solution of Plant Preservative Mixture (PPM, Plant Cell Technology, USA) with shaking at 100 rpm for 8 hours at 28°C (‘PPM protocol’) ...
-
No products found
because this supplier's products are not listed.
Wenwei Li, et al.,
bioRxiv - Microbiology 2021
Quote:
... and homogenized in 1 mL of serum free RPMI media containing penicillin-streptomycin and homogenized in 2 mL tube containing 1.5 mm Zirconium beads with BeadBug 6 homogenizer (Benchmark Scientific, TEquipment Inc). Virus titers were measured using three highly correlative methods ...