-
No products found
because this supplier's products are not listed.
Taylor Hart, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and ≥99% 4-methyl-3-heptanol and 99% 6-methyl-5-hepten-2-one from Sigma-Aldrich (Item numbers M48309 and M48805-100ML ...
-
No products found
because this supplier's products are not listed.
Jaakko Haverinen, Minna Hassinen, Matti Vornanen,
bioRxiv - Physiology 2021
Quote:
... L-364,373 (R-L3 or 5-(2-Fluorophenyl)-1,3-dihydro-3-(1H-indol-3-ylmethyl)-1-methyl-2H-1,4-benzodiazepin-2-one) (Tocris Cookson; Bristol, UK) and mefenamic (dimethylphenylaminobenzoic ...
-
No products found
because this supplier's products are not listed.
Yanan Wang, et al.,
bioRxiv - Zoology 2020
Quote:
... 2’-(4-ethoxyphenyl)-5-(4-methyl-1-piperazinyl)-23491-52-3 (Hoechst 33342, trihydrochloride, trihydrate, Life Technologies, H3570) in water for 20 min ...
-
No products found
because this supplier's products are not listed.
Nitin Wadhwani, et al.,
bioRxiv - Cancer Biology 2022
Quote:
SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
No products found
because this supplier's products are not listed.
Nienke Willemsen, et al.,
bioRxiv - Pathology 2022
Quote:
... and Proteasome 20S alpha 1+2+3+5+6+7 (Abcam, ab22674). After washing with TBS-T (200 mM Tris (Merck) ...
-
No products found
because this supplier's products are not listed.
Lisa Weixler, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... anti-tubulin 1:5000 (B-5-1-2 Santa Cruz). For slot blotting ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Tuan Minh Tran, et al.,
bioRxiv - Plant Biology 2020
Quote:
DSF (cis-11-methyl-2-dodecenonic) was purchased from Merck and dissolved in DMSO to obtain 100 mM stock ...
-
No products found
because this supplier's products are not listed.
Konstadinos Moissoglu, et al.,
bioRxiv - Cell Biology 2020
Quote:
... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Qian Chen, et al.,
bioRxiv - Genomics 2020
Quote:
... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
No products found
because this supplier's products are not listed.
Nicholas A. W. Bell, et al.,
bioRxiv - Biophysics 2020
Quote:
... of λ-DNA using the following primers: 5’-CGAACTCTTCAAATTCTTCTTCCA-3’ and 5’-GATTGCTCTTCTGTAAGGTTTTG-3’ with a 5:1 ratio of dTTP:biotin-11-dUTP (Jena Bioscience). Similarly ...
-
No products found
because this supplier's products are not listed.
Dougald M. Monroe, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 4 μM lipid vesicles (Avanti Polar Lipids PS:PC:PE 3:2:5), and FV (0 ...
-
No products found
because this supplier's products are not listed.
Peter D. Olson, et al.,
bioRxiv - Genomics 2020
Quote:
... was synthesised commercially and then labelled with digoxigenin-11-2’-deoxyuridine-5’-triphosphate (DIG-11-dUTP) using terminal transferase (Roche) according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Anastasia Selyutina, et al.,
bioRxiv - Microbiology 2020
Quote:
... supplemented with 5 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (Corning, Corning, NY, USA), 50 μg/ml penicillin/streptomycin (Corning) ...
-
No products found
because this supplier's products are not listed.
Simon Lind, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and AR-C118925 {5-[[5-(2,8-dimethyl-5H-dibenzo[a,d]cyclohepten-5-yl)-3,4-dihydro-2-oxo-4-thioxo-1(2H)-pyrimidinyl]methyl]-N-2H-tetrazol-5-yl-2-furancarboxamide} were obtained from Calbiochem-Merck Millipore (Billerica ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Estefanía Lozano-Andrés, et al.,
bioRxiv - Biophysics 2022
Quote:
... #131-8; #130-6; #130-5; #130-3 and 2 μm lot MM2307#156; #159.1; #159.2; #122.3, BD Biosciences, San Jose, CA). For calibration of the fluorescence axis in the PE channel ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
Stephanie S. Kim, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ...
-
No products found
because this supplier's products are not listed.
Thomas C. Harper, et al.,
bioRxiv - Immunology 2023
Quote:
... 5 ng/ml IL-11 (PeproTech, 200-11), 25 ng/ml IGF-1 (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Rajkumar Sadasivam, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 2-Hydroxyethyl methacrylate (99.99%, TCI), Ethylene glycol (SRL) ...
-
No products found
because this supplier's products are not listed.
Luisa Saecker, Hanns Häberlein, Sebastian Franken,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... 1-[2-chloro-6-[[(3-iodophenyl)methyl]amino]-9H-purin-9-yl]-1-deoxy-N-methyl-β-D-ribofuranuronamide (2-Chloro-IB-MECA; Cayman Chemicals, 163042-96-4), [2-Amino-4-[3-(trifluoromethyl)phenyl]-3-thienyl] phenylmethanone (VCP 171 ...
-
No products found
because this supplier's products are not listed.
Ferdinand Althammer, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
No products found
because this supplier's products are not listed.
Elizabeth Min, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Smad 2/3 (1:1000; Cell Signaling; #8685S), P-Smad 1/5/8 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Mark A. Rutherford, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-diaminobenzidine plus nickel (DAB; Vector Laboratories Kit; 2-5 min reaction). Sections were analyzed with an Olympus BX51 upright microscope ...
-
No products found
because this supplier's products are not listed.
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Addgene)[70] in a ratio of 5:3:2 using polyethylenimine (24765-2, Polysciences). Virus supernatant was harvested 30 h after transfection ...
-
No products found
because this supplier's products are not listed.
Jianjian Zhao, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... EA (ethyl acetate, 2×10-3 in dilution, Alfa Aesar) and IA (isoamyl acetate ...
-
No products found
because this supplier's products are not listed.
Michael Chabot, et al.,
bioRxiv - Biochemistry 2020
Quote:
... HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (VWR, Radnor, PA), NaCl (VWR) ...
-
No products found
because this supplier's products are not listed.
Jihae Shin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
No products found
because this supplier's products are not listed.
Sunniyat Rahman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
No products found
because this supplier's products are not listed.
Bolutife Fakoya, et al.,
bioRxiv - Microbiology 2021
Quote:
... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Hannah M. Oberle, et al.,
bioRxiv - Neuroscience 2023
Quote:
... breeder pairs from our colony (Figures 2-10) or 5-8 week old male and female C57/Bl6J mice ordered from Jackson labs (Figure 11; stock # 000664). For in vivo experiments with wild-type mice (of either sex) ...
-
No products found
because this supplier's products are not listed.
Cristina Solana-Manrique, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 1% (v/v) ampholytes (pH 3-11 NL; GE Healthcare) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Yu Ti Cheng, et al.,
bioRxiv - Plant Biology 2023
Quote:
Roughly 30,000 Arabidopsis bak1-5 bkk1-1 cerk1-2 (bbc) seeds were mutagenized using 0.2% ethyl methanesulfonate (EMS). Mutagenized M1 seeds were sown on soil and allowed to grow to set seeds ...
-
No products found
because this supplier's products are not listed.
Christopher Cherry, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Cell nuclei were then counterstained with 4′,6-diamidino-2-phenylindole (DAPI) for 5 min before being mounted using DAKO mounting medium (Agilent, catalog no. S302380–2). Imaging of the histological samples was performed on the Microscope Axio Imager.A2 (Carl Zeiss Microscopy ...
-
No products found
because this supplier's products are not listed.
Yu-Chia Chen, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Samples for Immunostaining were fixed in 2% PFA or 4% 1-ethyl-3 (3-dimethylaminopropyl)-carbodiimide (EDAC, Carbosynth, Berkshire, UK). The fixed brains were dissected to enhance antigen presentation and to improve image quality.
-
No products found
because this supplier's products are not listed.
Mariam Lotfy Khaled, et al.,
bioRxiv - Cancer Biology 2023
Quote:
3-methyl-2-oxovaleric acid sodium salt (KMV) (Toronto Research Chemical), 4-methyl-2-oxovaleric acid (KIC ...
-
No products found
because this supplier's products are not listed.
Daisuke Tone, et al.,
bioRxiv - Neuroscience 2021
Quote:
... or 3.3 mM (Figure 5-figure supplement 1 and 8) ATP and 5 µM ProfilerPro Kinase Peptide Substrate 11 5-FAM-KKLNRTLSVA-COOH (PerkinElmer, U.S.A.), in the presence or absence of 0.66 µM CaM (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Marin Boutonnet, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 2-methyl-6-(phenylethynyl)-pyridine hydrochloride (MPEP, HelloBio®); human angiotensin II (HelloBio®) ...
-
No products found
because this supplier's products are not listed.
Amin Zargar, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... 5-methyl-6-(propan-2-yl)oxan-2-one was synthesized by Enamine (Cincinnati, USA) to greater than 95% purity.
-
No products found
because this supplier's products are not listed.
Kevin W. Ng, et al.,
bioRxiv - Immunology 2021
Quote:
... IgA (Clone 11-44-2, Southern Biotech), and IgM (Clone RMM-1 ...
-
No products found
because this supplier's products are not listed.
Kai Dünser, et al.,
bioRxiv - Plant Biology 2021
Quote:
... 2′,7′-Bis(2-carboxyethyl)-5(6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM) from Biotium (CA, USA), Wortmannin (WM ...
-
No products found
because this supplier's products are not listed.
Josephine Bock, et al.,
bioRxiv - Cell Biology 2021
Quote:
... the small hairpin (shRNA)-expressing vectors pSUPER.neo (R4-1) (Fleig et al., 2012) and a pRS vector-based construct targeting 5’- ATGAGGAGACAGCGGCTTCACAGATTCGA-3’ (R4-2) (OriGene) were used ...
-
No products found
because this supplier's products are not listed.
Ayşe N. Erdoğan, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... 8-oxo-2’-deoxyguanosine-5’-triphosphate (8-oxo-dGTP) and 2’-deoxy-P-nucleoside-5’-triphosphate (dPTP) (TriLink). For each library ...
-
Cat# HY-W013014-500 mg,
500 mg, USD $50.0
Ask
Ziyue Z Zhang, et al.,
bioRxiv - Microbiology 2024
Quote:
... OA (MedChemExpress, NJ, CAS# 480-11-5) or PYR (Tokyo Chemical Industry ...
-
No products found
because this supplier's products are not listed.
Alexia Polissidis, et al.,
bioRxiv - Neuroscience 2021
Quote:
For GBA quantification (n=5 for 4 WPI, n=3 for 8 WPI), the surface function of the Imaris software was used to select only GFP-positive cells by appropriately adjusting the number of voxels as well as the intensity of the GFP channel in the threshold tab ...
-
No products found
because this supplier's products are not listed.
S. P. Maher, et al.,
bioRxiv - Cell Biology 2023
Quote:
... vivax cases were infected into PHH lot BGW at day 2 post-seed (for case 1) or day 3 post-seed (for cases 2 and 3) in 384-well plates (Greiner Bio-One cat 781956) using the same methods for initiating P ...
-
No products found
because this supplier's products are not listed.
Alexandros Sfikas, et al.,
bioRxiv - Cell Biology 2019
Quote:
... siRNA 2 5’ GCCCUAUCCCUUUACGUCA (Eurogentec). Dharmacon ONTarget plus SMARTpool ...