-
No products found
because this supplier's products are not listed.
Natalia Sanchez de Groot, et al.,
bioRxiv - Systems Biology 2019
Quote:
... Aβ42 was inserted 3’prime of the GFP (TRP-URA-AB vector) using the In-Fusion® HD Cloning Kit (Clontech ...
-
No products found
because this supplier's products are not listed.
Gwen R. Buel, et al.,
bioRxiv - Biophysics 2022
Quote:
... and incubated with 2 mM DSP (ChemScene CS-0068460 ...
-
No products found
because this supplier's products are not listed.
Joshua Johnson, et al.,
bioRxiv - Physiology 2020
Quote:
... Endogenous peroxidase blocking was performed by using 3% hydrogen peroxide (Labchem, Cat # LC154301). Sections were then washed in water ...
-
No products found
because this supplier's products are not listed.
Joanna M. Cooper, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Alpha-2-macroglobulin was purchased from Athens Research and was activated by methylamine as described (Ashcom et al. ...
-
No products found
because this supplier's products are not listed.
Sandra Schwarz, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... respective wells were treated with 400µM PI-9i (1,3-Benzoxazole-6-carboxylic acid, Advanced ChemBlocks Inc, Hayward, CA, USA). Following pre-treatment ...
-
Cat# H2G029,
USD $125.0/pack
Ask
Hanieh Ghassabian, et al.,
bioRxiv - Microbiology 2020
Quote:
... α-IE1&2 mAb (Virusys Corporation, #CA003-1; 1:10,000), α-UL44 mAb (Virusys Corporation ...
-
No products found
because this supplier's products are not listed.
Edward Sullivan, et al.,
bioRxiv - Microbiology 2021
Quote:
The BioSensor SARS-CoV-2 Ag Kit (Oxford Biosystems) was used in accordance with manufacturer’s instructions to process swab samples from hamsters ...
-
No products found
because this supplier's products are not listed.
Cian Schmitt-Ulms, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... and Cypridina Luciferase Assay reagent (Targeting Systems, VLAR-2) respectively ...
-
No products found
because this supplier's products are not listed.
Elea Boucard, et al.,
bioRxiv - Bioengineering 2021
Quote:
... FSF and embryonic lung fibroblasts MRC-5 (RD-Biotech, Besançon, France) were expanded in DMEM supplemented with ...
-
No products found
because this supplier's products are not listed.
Yara Eid Mutlak, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Phospho-Serine antibody was from ECM biosciences (Cat# PP2551, lot# 5). Anti-Laminin (Cat# L9393 ...
-
No products found
because this supplier's products are not listed.
Mariano A. Ostuni, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 20 glycerol and with 5 Critical Micellar Concentration of CALX173ACE (CALIXAR). CALX173ACE solubilized CX3CL1 was loaded into magnetic beads previously crosslinked to polyclonal anti-CX3CL1 antibody using an IP kit (Pierce ...
-
No products found
because this supplier's products are not listed.
Abdugaffor Ablazov, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Approximately 20 mg of lyophilized rice samples were extracted twice with 2 mL of ethyl acetate containing 2 ng of D3-zaxinone (customized synthesis; Buchem B.V., Apeldoorn, The Netherlands). After that ...
-
No products found
because this supplier's products are not listed.
Jessica L. Kelliher, et al.,
bioRxiv - Microbiology 2023
Quote:
... Endpoint kinase assays were performed by mixing 3 μg purified PrkA1- 338 with the indicated combinations of ∼3x molar excess of substrate to kinase (6 μg of the generic kinase substrate myelin basic protein [MBP; Novatein Biosciences, Woburn ...
-
No products found
because this supplier's products are not listed.
Yuan-Chen Tsai, et al.,
bioRxiv - Neuroscience 2022
Quote:
... AP-5 (50 μM, almone labs) and tetrodotoxin (1 μM, Affix Scientific). 10 min after establishing the whole-cell mode ...
-
No products found
because this supplier's products are not listed.
Luca Braglia, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Each reaction was carried out with 4 μL master mix (Titan HotTaq EvaGreen, BIOATLAS), 0.5 μL of each primer (from a 100 μM stock ...
-
No products found
because this supplier's products are not listed.
Biao Yuan, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and desalting (3 min) was driven with an isocratic HPLC pump (IPro-500, IRIS Technologies, Lawrence, KS) at a flow rate of 100 µL min-1 through the 50-µL sample loop ...
-
No products found
because this supplier's products are not listed.
Lucy I. Crouch, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Control samples were digested with PNGase F (1 μl, 5 mU, QA-Bio) For Pngase-003341 the final enzyme concentration was 1 μM ...
-
No products found
because this supplier's products are not listed.
Yalda Afshar, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Confluent endothelial monolayers were grown on tissue culture treated 6-well plates (Falcon #08-772-1B) in complete MCDB-131 media (VEC Technologies # MCDB131-WOFBS) plus 10% FBS (Omega Scientific #FB-11 ...
-
No products found
because this supplier's products are not listed.
Colin Kremitzki, et al.,
bioRxiv - Genetics 2023
Quote:
Lentiviruses carrying the gRNA libraries were packaged into 8×106 HEK 293T cells/well in a 6-well plate (TPP92006, MIDSCI, Fenton, MO, USA), using the TransIT Lentivirus transfection reagent (MIR 6600 ...
-
No products found
because this supplier's products are not listed.
Fangyuan Ding, et al.,
bioRxiv - Systems Biology 2020
Quote:
... were coated with 5 ug/ml Human Fibronectin (Oxford Biomedical Research, Rochester Hills, MI) in PBS buffer for 1hr at room temperature ...
-
No products found
because this supplier's products are not listed.
Shannon J. McKie, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Topo VI (5-80 nM) was incubated with 2.5 nM negatively supercoiled pBR322* (Inspiralis) in a 30 μL reaction volume with Cleavage Buffer (20 mM Bis-Tris propane (pH 7) ...
-
No products found
because this supplier's products are not listed.
Pengchao Wang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... for 2 min and then subjected to the imaging system (UVITEC Cambridge) to record signals.
-
No products found
because this supplier's products are not listed.
Johann Peltier, et al.,
bioRxiv - Microbiology 2020
Quote:
... Western blotting was performed with anti-HA antibodies (1:2, 000) (Osenses) using standard methods.
-
No products found
because this supplier's products are not listed.
Gary Reynolds, et al.,
bioRxiv - Immunology 2020
Quote:
... then resuspended in 200 μl of flow buffer per 106 cells with 3 μM DAPI (Sysmex Partec, 05-5005). Cells were then run through a Fortessa X20 for analysis ...
-
No products found
because this supplier's products are not listed.
Elizabeth Fleming, et al.,
bioRxiv - Microbiology 2021
Quote:
... sites were swabbed rigorously using 2 PurFlock Ultra buccal swabs (Puritan Medical Products) for each site for thirty seconds before one swab was submerged into a 1.5mL Eppendorf tube containing 500μl R2A broth (R2A ...
-
No products found
because this supplier's products are not listed.
Filipy Borghi, et al.,
bioRxiv - Physiology 2021
Quote:
... 4 °C and analyzed using the commercial ELISA kit (Diagnostics Biochem Canada Inc. - Ref CAN-C-290) at the Laboratory of Stress Studies (LABEEST ...
-
No products found
because this supplier's products are not listed.
Maia Moog, Scott C. Baraban,
bioRxiv - Neuroscience 2022
Quote:
... were amplified at a gain of 20x and filtered at 1 kHz (−3 dB; eight-pole Bessel; Cygnus Technology, Inc.), digitized at 10 kHz using a Digidata 1320 A/D interface (Molecular Devices ...
-
No products found
because this supplier's products are not listed.
Sarah C. Donnelly, et al.,
bioRxiv - Microbiology 2022
Quote:
... samples containing 1–3 mg/mL of protein were evaluated using ICP-MS (Biotron Analytical Services, Western University, London, Canada). Briefly ...
-
No products found
because this supplier's products are not listed.
Kevin G. Burt, et al.,
bioRxiv - Bioengineering 2023
Quote:
... IVDs were cultured in DMEM/F12 with 5% Fetal Bovine Serum (FBS, Crystalgen, Cat #FBS-500HI) and 1 % Penicillin-Streptomycin ...
-
No products found
because this supplier's products are not listed.
Erika Flores, et al.,
bioRxiv - Microbiology 2023
Quote:
... and 5 μL of each dilution was plated on CHROMagar™ O157 plates (Drg International Inc). The plates were incubated at 30 °C for 24 h ...
-
No products found
because this supplier's products are not listed.
Joanne L. Usher, et al.,
bioRxiv - Cell Biology 2021
Quote:
... were spiked in at concentrations as indicated in the Supplementary Table 1 and the sample was loaded into a StageTip containing 4 plugs of C18 substrate (SPE-Disks-Bio-C18-100.47.20, AffiniSEP) that had been assembled ...
-
No products found
because this supplier's products are not listed.
Romain Lanotte, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Cells were then transiently transfected with 5 μg of each construct using Metafectene (Biontex Lab.; München, Germany), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Charlène Iltis, et al.,
bioRxiv - Immunology 2021
Quote:
... membranes were stripped at 4°C in agitation using Antibody stripping buffer 1X for 10 minutes (Gene Bio-Application). Protein bands were quantified using ImageJ software ...
-
No products found
because this supplier's products are not listed.
Yansheng Ye, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 150 mM NaCl and 2 mM TCEP containing 6.5 mg/mL phage Pf1 (ASLA BIOTECH).
-
No products found
because this supplier's products are not listed.
Brian C. Russo, et al.,
bioRxiv - Microbiology 2021
Quote:
... The cells were then incubated overnight at 4°C with rabbit anti-Shigella conjugated to FITC (ViroStat, catalog no. 0903). The next day ...
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Tongcui Ma, et al.,
bioRxiv - Microbiology 2023
Quote:
... or conjugated in-house with X8 antibody-labeling kits (Standard BioTools) and stored at 4°C in Antibody Stabilizer (Boca Scientific) supplemented with 0.05% sodium azide ...
-
No products found
because this supplier's products are not listed.
William J Dower, et al.,
bioRxiv - Immunology 2023
Quote:
... for 5-10 min at 25°C and the reaction was stopped using STOP solution (Surmodics Cat# LSTP-1000-01).
-
No products found
because this supplier's products are not listed.
Yuichiro Honda, et al.,
bioRxiv - Pathology 2020
Quote:
... The sections were blocked with 5% bovine serum albumin in PBS for 60 min and incubated overnight at 4°C with a mouse anti-CD-11b primary antibody (1:2000; BMA Biomedicals, Augst, Switzerland) or a rabbit polyclonal anti-dystrophin primary antibody (1:1000 ...
-
No products found
because this supplier's products are not listed.
Charles E. Mackay, et al.,
bioRxiv - Physiology 2021
Quote:
... Arterial segments 1-2 mm in length were cannulated at each end in a perfusion chamber (Living Systems Instrumentation) continuously perfused with PSS and maintained at 37°C ...
-
No products found
because this supplier's products are not listed.
Dorothee Jakob, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... we applied the spider toxin peptide Grammostola spatulata mechanotoxin 4 (GsMTx4) L-isomer (10 μmol/L, H20 as solvent, CSBio, Menlo Park, CA, USA), a known blocker of cation non-selective SAC ...
-
No products found
because this supplier's products are not listed.
Devin Rocks, et al.,
bioRxiv - Neuroscience 2023
Quote:
... n=5/sex/group) were rinsed with distilled water and underwent the Golgi-Cox staining procedure (Golgi-Cox OptimStain Kit, Hitobiotec Inc. #HTKNS1125) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Ryota Maeda, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Antigen test kits detecting the SARS-CoV-2 spike based on nitrocellulose lateral flow assays were developed by Yamato Scientific Co. ...
-
No products found
because this supplier's products are not listed.
Angus M Sidore, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... The individual wells were then washed >5 times using 2X Bind & Wash Buffer and a 384-Well Post Magnetic Plate (Permagen Labware, Peabody, MA). After washing ...
-
No products found
because this supplier's products are not listed.
Geraldine Nouailles, et al.,
bioRxiv - Immunology 2022
Quote:
... The plates were covered and incubated for 2 h at room temperature before the washing step was repeated and 50 μL of secondary antibody (Brookwood biomedical, Rabbit Anti-Hamster IgA ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Robert V. Blair, et al.,
bioRxiv - Pathology 2020
Quote:
Serum samples collected at preinfection and at necropsy were tested for binding IgG antibodies against SARS-CoV-2 S1/S2 proteins using an ELISA kit from XpressBio (cat# SP864C). The assays were performed per directions of the manufacturer ...
-
No products found
because this supplier's products are not listed.
Jordina Rincon-Torroella, et al.,
bioRxiv - Cancer Biology 2023
Quote:
MIA PaCa-2 or Panc 02.13 cells were transduced with a CMV-Firefly luciferase lentivirus carrying a puromycin-selectable marker (Cellomics Tech; Halethorpe, MD, USA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Neha E. H. Dinesh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... For sanger sequencing PCR reactions were performed using specific oligos against the target FN domains (Supp Table 2) and Taq DNA Polymerase kit (ZmTech Scientifique; Catalogue #T207025) and analyzed on 2% agarose gels ...
-
No products found
because this supplier's products are not listed.
Tyler P. Nicholas, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... or to silver nanoparticles (AgNP; 20 nm, gold-core, citrate-coated, at 1 mg/mL in 2 mM sodium citrate; nanoComposix, San Diego, CA, USA) for an acute exposure of 24 hours ...