-
No products found
because this supplier's products are not listed.
Serena Notartomaso, et al.,
bioRxiv - Neuroscience 2024
Quote:
... VU0360172 [N-cyclobutyl-6-(2-(3-fluorophenyl)ethynyl) pyridine-3-carboxamide] was purchased from Tocris Bioscience (Bristol ...
-
No products found
because this supplier's products are not listed.
Lucie Olejníková-Ladislavová, et al.,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
The 5-HT2C antagonist 6-Chloro-2,3-dihydro-5-methyl-N-[6-[(2-methyl-3-pyridinyl)oxy]-3-pyridinyl]-1H-indole-1-carboxamide dihydrochloride (SB242084; Sigma Aldrich) at a dose of 1.0 mg/kg.
-
No products found
because this supplier's products are not listed.
Haiyan Li, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 3) latrunculin-b (Lat-B; 2 μM; Fisher Scientific), 4 ...
-
No products found
because this supplier's products are not listed.
Rosemaria Serradimigni, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... N-[4-chloro-3-(trifluoromethyl)phenyl]-2-ethoxy-6-pentadecyl-benzamide (CTPB) (CAS #: 586976-24-1) (>99% purity) was purchased from Abcam (Cambridge, United Kingdom). For both chemicals ...
-
No products found
because this supplier's products are not listed.
Jasmine Phénix, et al.,
bioRxiv - Neuroscience 2024
Quote:
... and pyridine (Merck, Germany, 9:3:1) in a GC vial for GC–mass selective detector non-cholesterol and oxysterol analysis ...
-
No products found
because this supplier's products are not listed.
Flora Birch, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and 6 ng/mL murine interleukin-3 (mIL-3) (Peprotech). Every two days ...
-
No products found
because this supplier's products are not listed.
Tzu-Yu Feng, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... anti-PDGF-B (F-3, Santa Cruz), anti-GAPDH antibody (6C5 ...
-
No products found
because this supplier's products are not listed.
Bolutife Fakoya, et al.,
bioRxiv - Microbiology 2021
Quote:
... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ...
-
No products found
because this supplier's products are not listed.
Christopher Douglas, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
John B. Moldovan, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... approximately 2-3×105 cells were plated per well in 6-well plates (Corning) and transfected with 0.25 μg of “driver” plasmid (pTMO2F3 ...
-
No products found
because this supplier's products are not listed.
Maria-Luisa del Rio, et al.,
bioRxiv - Immunology 2024
Quote:
... and 2 mg/ml 3-[4,5-dimethylthiazol-2-yl]-5-[3-carboxymethoxyphenyl]2-[4-sulfophenyl]-2H-tetrazolium (PMS, Promega) (1/20 ...
-
No products found
because this supplier's products are not listed.
Sachithrani U. Madugalle, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The original CIRTs-6: B-defensin 3-TBP6.7-YTHDF2 plasmid (# 132544) was purchased from Addgene and the YTHDF2 domain was PCR amplified and cloned into the AgeI and NheI sites ...
-
No products found
because this supplier's products are not listed.
T Winogrodzki, et al.,
bioRxiv - Bioengineering 2022
Quote:
... (3) LPS and 150 μg/ml Polymyxin B (Invivogen) for 45 and 90 min ...
-
No products found
because this supplier's products are not listed.
Neha Nanajkar, et al.,
bioRxiv - Biophysics 2024
Quote:
... composed of 3:1 1palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC): 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoL-serine (POPS) (Avanti Polar Lipids, Alabaster, AL) were prepared using extrusion and sonication methods ...
-
No products found
because this supplier's products are not listed.
José A. Noriega-Prieto, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or the IGF-1R antagonist 7-[cis-3-(1-azetidinylmethyl)cyclobutyl]-5-[3-(phenylmethoxy)phenyl]-7H-pyrrolo[2,3-]pyrimidin-4-amine (NVP-AEW 541, 40 μM; Cayman Chemicals) plus IGF-1 were infused into the IL ...
-
No products found
because this supplier's products are not listed.
Paul-Lennard Mendez, et al.,
bioRxiv - Genomics 2024
Quote:
... SMAD2/3 (SMAD 2/3 XP, Cell Signaling Technology 8685) or isotype control (Rabbit IgG XP ...
-
No products found
because this supplier's products are not listed.
Ffion R Hammond, et al.,
bioRxiv - Immunology 2023
Quote:
... 1μl Cas9 (diluted 1:3 in diluent B, NEB), 1μl water (water was replaced with 100ng/μl trib1 RNA for cop1 experiments) ...
-
No products found
because this supplier's products are not listed.
Jessica Y Chen, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mice used were 2-3-month-old C57BL/6 (Jackson Laboratories, Bar Harbor, ME, #000664) at the time of injury ...
-
No products found
because this supplier's products are not listed.
Michael H Jones, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 3 and 6 days and subsequently tested by IL-2 ELISA (R&D Systems) according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Pinanong Na-Phatthalung, et al.,
bioRxiv - Immunology 2023
Quote:
... The nuclei were stained with 3 µM DAPI (4’,6-diamidino-2-phenylindole; BioLegend, #422801) for 5 min ...
-
No products found
because this supplier's products are not listed.
Patrick O. Byrne, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... IgG(1/2/3)-FITC (BD Pharmingen), and IgM-PE-Cy7 (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
Konstantinos Sofiadis, et al.,
bioRxiv - Genomics 2020
Quote:
... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Christopher B. Kaelin, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Libraries were constructed with version 2 (stage 16a) or version 3 (stage15 a/b) chemistry and sequenced on a single HiSeqX (Illumina) lane to generate 400-450 million paired-end 150 bp reads (Supplementary Table 4).
-
No products found
because this supplier's products are not listed.
Sina Ibne Noor, et al.,
bioRxiv - Biochemistry 2020
Quote:
... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
No products found
because this supplier's products are not listed.
Takashi Handa, Rie Harukuni, Tomoki Fukai,
bioRxiv - Neuroscience 2020
Quote:
... and filled with 2-3% Neurobiotin (Vector Laboratories) dissolved in 0.5 M potassium chloride (9-19 MΩ) ...
-
No products found
because this supplier's products are not listed.
Sofia E. Luna, et al.,
bioRxiv - Genetics 2024
Quote:
2-3 days post-electroporation HSPCs were plated in SmartDish 6-well plates (cat.: 27370; STEMCELL Technologies, Vancouver, Canada) containing MethoCult H4434 Classic or MethoCult H4434 Classic without EPO (cat. ...
-
No products found
because this supplier's products are not listed.
Elzbieta Sarnowska, et al.,
bioRxiv - Plant Biology 2021
Quote:
... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
No products found
because this supplier's products are not listed.
Pierre-Louis Hollier, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the pellet was washed 3 times with the buffer B and transferred in an enzyme solution (2 mg/mL Collagenase/Dispase (Roche, Bale, Switzerland), 0,147 µg/mL TLCK (Lonza ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Ragunathan Bava Ganesh, Sebastian J. Maerkl,
bioRxiv - Synthetic Biology 2024
Quote:
... Purification column was prepared using 2-3 mL IMAC Sepharose 6 Fast Flow beads (GE Healthcare) and charged with 0.1 N Nickel sulphate solution ...
-
No products found
because this supplier's products are not listed.
Gina Partipilo, et al.,
bioRxiv - Bioengineering 2024
Quote:
... disodium;4-[3-pyridin-2-yl-6-(4- sulfonatophenyl)-1,2,4-triazin-5-yl]benzenesulfonate hydrate (Ferrozine, VWR) All media components were autoclaved or sterilized using 0.2 μm PES filters.
-
No products found
because this supplier's products are not listed.
Jin-Woong Heo, et al.,
bioRxiv - Physiology 2023
Quote:
... for 2□min and 3% lead citrate (EMS, 22410) for 1□min ...
-
No products found
because this supplier's products are not listed.
Katharina Best, et al.,
bioRxiv - Biochemistry 2022
Quote:
... R3/3 copper grids with a 2 nm carbon coating (Quantifoil) using a Vitrobot mark IV (FEI ...
-
No products found
because this supplier's products are not listed.
Marta E. Stremska, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 μm (#19118-2; Polysciences) or 6 μm (#17145-4 ...
-
No products found
because this supplier's products are not listed.
Haribaskar Ramachandran, et al.,
bioRxiv - Genomics 2021
Quote:
... cells were blocked with 3%BSA diluted in PBS for 1h at RT and then incubated with anti-CD-19-PE antibody (1:50) in 3% BSA-PBS (Miltenyi Biotec) for 1h at RT ...
-
No products found
because this supplier's products are not listed.
Yili Zhang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Intracellular recordings from MNs were made with 10-20 MΩ sharp electrodes filled with 3 M potassium acetate connected to an Axoclamp 2-B amplifier (Molecular Devices). Data acquisition and analyses of resting potential ...
-
No products found
because this supplier's products are not listed.
Sarah Hyllekvist Jørgensen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and AKT 1/2/3 (p-S473) Assay Kits (PerkinElmer). Cell lysis and SureFire Assay were performed following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
No products found
because this supplier's products are not listed.
Xin-Miao Zhang, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... B-cell lymphoma-2 associated X protein antibody (Bax, 60267-1-Ig), and cysteinyl aspartate specific puroteinase-3 antibody (Caspase-3, 66470-2-Ig) were purchased from Proteintech (Wuhan, China), and the p53 antibody (Ab131442) ...
-
No products found
because this supplier's products are not listed.
Qiao Wen Tan, Emmanuel Tan, Marek Mutwil,
bioRxiv - Plant Biology 2024
Quote:
... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
No products found
because this supplier's products are not listed.
Bram Meijlink, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Ultrasound was applied under an incidence angle of 45° in relation to the CLINIcell using a single element focused transducer (2.25 MHz center frequency, 76.2 mm focal length, -6 dB beam width at 2 MHz of 3 mm, V305, Panametrics-NDT, Olympus). The ultrasound pressure output was calibrated using a 1-mm diameter needle hydrophone (PA2293 ...
-
No products found
because this supplier's products are not listed.
Nittay Meroz, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... The optical density was then measured using 6 automated plate readers (3 Epoch2 microplate reader - BioTek and 3 Synergy microplate reader - BioTek) simultaneously ...
-
No products found
because this supplier's products are not listed.
Vignesh Venkatakrishnan, et al.,
bioRxiv - Biochemistry 2020
Quote:
... disrupted with a tip sonicator at 1/3 power (8 MHz) for 3 × 30 seconds on ice and fractionated by ultracentrifugation (100’000 x g, 1H, Beckman TLA 120.2 rotor). The luminal fraction was concentrated to around 50 µL on a 3 kDa MWCO Amicon Ultra 0.5 mL centrifugal filter while membrane pellets were dissolved in 50 µL TBS with 2% SDS ...
-
No products found
because this supplier's products are not listed.
Ester Orav, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Sections were washed 3 x 10 min in PBS and incubated 1h with blocking solution containing 10% normal goat serum (NGS, MP Biomedicals, USA), 3% BSA in PBST ...
-
No products found
because this supplier's products are not listed.
Richard B Crouse, et al.,
bioRxiv - Neuroscience 2020
Quote:
... blocked for 2-3 hours (0.3% Triton X-100, American Bioanalytical, Canton, MA; 3% normal donkey serum, Jackson ImmunoResearch, West Grove, PA), then incubated overnight with primary antibodies (1:1000 + 1% normal donkey serum) ...
-
No products found
because this supplier's products are not listed.
Tingting Li, et al.,
bioRxiv - Immunology 2021
Quote:
... The gradient concentrations of SARS-CoV-2 S1 or an artificial chimeric construct carrying 3 mutations on B.1.351 RBD and SD614G (B.1.351 S1) (Sino Biological, Beijing, China) were prepared (2-fold dilutions ...
-
No products found
because this supplier's products are not listed.
Esmeralda Vásquez Pacheco, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 × 105 cells were seeded per well in 6-well plates (Greiner Bio-One). The following day ...
-
No products found
because this supplier's products are not listed.
Elena Simonazzi, et al.,
bioRxiv - Neuroscience 2021
Quote:
... d using a resonant scanning two-photon microscope (Thorlabs, B-Scope) with a 16x 0.8 NA objective with 3-mm working distance (Nikon). Mice were awake during the imaging session and positioned on a cylindrical treadmill ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...