-
No products found
because this supplier's products are not listed.
Katerina Stepankova, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and anti-VGLUT1/2 (Synaptic Systems, #1235503, 1:800, 3 days). Goat anti-host antibodies of the respective primary antibodies conjugated with Alexa Fluor 405 ...
-
No products found
because this supplier's products are not listed.
Wei Huang, et al.,
bioRxiv - Genetics 2023
Quote:
... 14-3-3 polyclonal antibody (Proteintech, Cat#14503-1-AP), and beta tubulin antibody (Abways Technology ...
-
No products found
because this supplier's products are not listed.
Patrícia D. Correia, et al.,
bioRxiv - Neuroscience 2023
Quote:
... rats were anesthetized with Isoflurane (Forene, Abbott; 2–3% in O2 and N2O at a ratio of 1:2). Following laminectomy at T8/9 and opening of the dura mater via a longitudinal cut ...
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
No products found
because this supplier's products are not listed.
Christos Georgiadis, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3% human serum (Seralab) +20 ng/ml human recombinant IL-2 (Miltenyi Biotec) and activated with TransAct reagent (Miltenyi Biotec) ...
-
No products found
because this supplier's products are not listed.
Jenny L. M. Digby, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... MEIS1/2/3 (Active Motif 39796) and LTL (Vectorshield FL-1321) ...
-
No products found
because this supplier's products are not listed.
Jérôme Montnach, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Low resistance borosilicate glass pipettes (2-3 MΩ; Sutter Instruments) were filled with a solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Bella Koltun, et al.,
bioRxiv - Neuroscience 2019
Quote:
... C57BL/6 WT pregnant dams 2-3 months of age were obtained weekly from local vendors (Envigo RMS, Jerusalem, Israel). Arc:dVenus mice (with a C57BL/6 background) ...
-
No products found
because this supplier's products are not listed.
Richard B Crouse, et al.,
bioRxiv - Neuroscience 2020
Quote:
... blocked for 2-3 hours (0.3% Triton X-100, American Bioanalytical, Canton, MA; 3% normal donkey serum, Jackson ImmunoResearch, West Grove, PA), then incubated overnight with primary antibodies (1:1000 + 1% normal donkey serum) ...
-
No products found
because this supplier's products are not listed.
Camille Danne, et al.,
bioRxiv - Immunology 2022
Quote:
Mice were administered drinking water supplemented with 2-3% (wt/vol) DSS (MP Biomedicals) for 5-7 days (depending on colitis severity of each experiment) ...
-
No products found
because this supplier's products are not listed.
Felix Michaud, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Data acquisition (filtered at 2–3 kHz and digitized at 10kHz; Digidata 1440, Molecular Devices, CA, USA) was performed using the Multiclamp 700B amplifier and the Clampex 10.9 software (Molecular Devices) ...
-
No products found
because this supplier's products are not listed.
Saphala Dhital, Naren R. Vyavahare,
bioRxiv - Bioengineering 2019
Quote:
DiR (1, 1-dioctadecyl-3, 3, 3, 3-tetramethylindotricarbocyanine iodide) (PromoCell GmbH, Heidelberg, Germany) loaded BSA (Seracare ...
-
No products found
because this supplier's products are not listed.
Felix Wagner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
No products found
because this supplier's products are not listed.
Vaky Abdelsayed, et al.,
bioRxiv - Biophysics 2022
Quote:
... including 2-color and 3-color STORM was performed on an IX83 Inverted microscope (Olympus) using a 100x 1.3NA objective (Olympus) ...
-
No products found
because this supplier's products are not listed.
Theresa K Leslie, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... then were incubated for 10 minutes at 21 °C in 1 μM 2′,7′-Bis(2-carboxyethyl)-5(6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM, Biotium) in PSS ...
-
DA agonist
Sold for research purposes only.
Cat# 1002.0, SKU# 1002-10 mg,
10mg, US $104.50 / EA, EURO, €95 / EA
Ask
Isabel R.K. Kuebler, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The MCH receptor antagonist 6-(4-Chloro-phenyl)-3-[3-methoxy-4-(2-pyrrolidin-1-yl-ethoxy)-phenyl]-3H-thieno[3,2-d]pyrimidin-4-one (GW803430) (Axon Medchem, Groningen, Netherlands) was freshly prepared the day of the treatment ...
-
No products found
because this supplier's products are not listed.
Erez Yirmiya, et al.,
bioRxiv - Genetics 2023
Quote:
... chip activation was made with a freshly prepared mixture of N-hydroxysuccinimide (50 mM in water) and 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (195 mM in water) for 7.5 min in DPBS (Sartorius, SKU 02-023-5A) (flow rate of 10 μL/min) ...
-
No products found
because this supplier's products are not listed.
Katrin Gerstmann, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Electrodes (3-6 MΩ, borosilicate glass Harvard Apparatus) were filled with a solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Soshi Noshita, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 3×104 cells were seeded into 2-well silicone culture insert (ib80209, ibidi) in a 35 mm dish and cultured overnight ...
-
No products found
because this supplier's products are not listed.
Reimi Tada, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Tadpoles and froglets anesthetized with 0.025% or 0.05% ethyl-3-aminobenzoate were observed under a fluorescence stereomicroscope (Nikon SMZ18) with a 0.5x objective lens using a GFP longpass filter (if in a fluorescent view ...
-
No products found
because this supplier's products are not listed.
Mingrong Zuo, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... total-JNK1/2/3 (Abclonal #A4867), CCL2/MCP1 (Abclonal # A23288).
-
No products found
because this supplier's products are not listed.
Anna V. Protasio, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Worms were rinsed in PBS (3×10mins, 3 × 1hr) and equilibriated in mounting media with 4’,6-diamidino-2-phenylindole DAPI (Fluoromount G, Southern Biotech, Birmingham, AL) overnight before mounting and imaging.
-
No products found
because this supplier's products are not listed.
Anna Ruzhanskaya, et al.,
bioRxiv - Biochemistry 2020
Quote:
... One was through twice daily measurement of 2 or 3 levels of QC specimens obtained from Beckman Coulter Inc ...
-
No products found
because this supplier's products are not listed.
Görkem Garipler, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and 2-inhibitor cocktail (3 mM CHIR (BioVision) and 1 mM PD0325901 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Oskar Staufer, et al.,
bioRxiv - Immunology 2022
Quote:
... cells were stained with anti-human ICAM-1-AlexaFluor647 (BioXcell, BE0020-2, 3 µM), anti-human CD58-AlexaFluor647 (BD Bioscience ...
-
No products found
because this supplier's products are not listed.
Yohan S.S. Auguste, et al.,
bioRxiv - Neuroscience 2022
Quote:
... subcutaneous] before being anesthetized using isoflurane (SomnoSuite, Kent Scientific; 3-5% induction, 1-2% maintenance). Once anesthetic depth was achieved ...
-
No products found
because this supplier's products are not listed.
Shaibu Oricha Bello, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Neutral red (3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride) (Solarbio, cat. N8160), Minimal Essential Medium/Earls Balance Salts (MEM/EBSS ...
-
No products found
because this supplier's products are not listed.
Eleonora Grisard, et al.,
bioRxiv - Cell Biology 2021
Quote:
... rabbit anti-human 14-3-3 1/1000 (EPR6380, GeneTex), rabbit anti-human Lamp1 1/1000 (clone EPR4204 ...
-
No products found
because this supplier's products are not listed.
Eve T. Beauchemin, et al.,
bioRxiv - Microbiology 2022
Quote:
... the bacteria were first incubated in 3 wells of a 96-well plate for 1 hour in an Epoch 2 Microplate Spectrophotometer (BioTek), with optical density measured at 600 nm (OD600) ...
-
No products found
because this supplier's products are not listed.
Kerri L. Miazgowicz, et al.,
bioRxiv - Microbiology 2022
Quote:
... Transfected cells were rapidly cooled and stained in blocking solution (dPBS with 2% (v/v) bovine serum albumin (BSA)) containing anti-MXRA8 (1:100, W040-3, MBL International), anti-hTIM1(1:100 ...
-
No products found
because this supplier's products are not listed.
Solanka E. Ledwaba, et al.,
bioRxiv - Microbiology 2020
Quote:
... 1:1000, Thermo Fisher Scientific, PA1-183; mouse anti-claudin-2, 3:500, Invitrogen, 325600; rabbit anti-claudin-1, 1:1000, Novus biological, NBP1-77036) and secondary antibodies (Cy3-conjugated AffiniPure donkey anti-rabbit ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Emily A. Rex, et al.,
bioRxiv - Microbiology 2023
Quote:
... IP of total SUMOylated protein fractions used either SUMO-1 or SUMO-2/3 Ab included with the Signal Seeker SUMOylation 1 or 2/3 Detection Kit (Cytoskeleton) and IPs were carried out according to the manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... sn-(1-oleoyl-2-hydroxy)-glycerol-3-phospho-sn-3′-(1′-oleoyl-2’-hydroxy)-glycerol (ammonium salt) (18:1 BMP (R,R); Avanti Polar Lipids) ...
-
2'3'-cyclic GAMP ( cGAMP ) FRET Detection / assay Kit
Cat# K081-F1,
1.0 ea, USD $390.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Stefano Cattaneo, et al.,
bioRxiv - Neuroscience 2019
Quote:
All drugs were obtained from Sigma except 2,3-dioxo-6-nitro-1,2,3,4-tetrahydrobenzo[f]quinoxaline-7-sulfonamide disodium salt (NBQX) and 2-(3-carboxypropyl)-3-amino-6-(4 methoxyphenyl)pyridazinium bromide (gabazine) which were obtained from Hello Bio (Bristol, UK).
-
No products found
because this supplier's products are not listed.
Valerie Betting, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... RNA was transferred to Hybond Nx nylon membranes (Amersham) and crosslinked using EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride) (Sigma) (Pall & Hamilton 2008). Membranes were pre-hybridized in Ultrahyb Oligo hybridization buffer (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Josephine Bock, et al.,
bioRxiv - Cell Biology 2021
Quote:
... the small hairpin (shRNA)-expressing vectors pSUPER.neo (R4-1) (Fleig et al., 2012) and a pRS vector-based construct targeting 5’- ATGAGGAGACAGCGGCTTCACAGATTCGA-3’ (R4-2) (OriGene) were used ...
-
No products found
because this supplier's products are not listed.
Yang Gao, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Lentiviral vectors were co-transfected with packaging vectors VSVG and gag/pol in a ratio of 3:1:2 into HEK293T cells using Trans-IT Transfection reagent (Mirus). Viral supernatants were collected at 48 and 72 hr post-transfection ...
-
No products found
because this supplier's products are not listed.
Caleb R. Carr, et al.,
bioRxiv - Microbiology 2024
Quote:
... 2 µL of 10 µM 3’ PacBio round 2 reverse primer (PacBio_3pri_RND2), and 25 µL KOD Hot Start Master Mix ...
-
No products found
because this supplier's products are not listed.
Aidan Pavao, et al.,
bioRxiv - Microbiology 2023
Quote:
... Ethyl [U-13C]2-hydroxybutyrate (Cambridge Isotope Laboratories, Inc.) approximated 2-hydroxybutyrate and 2-aminobutyrate signals ...
-
2-Methyltetrahydrofuran-3-one is a volatile constituent of the aroma complex of roasted coffee.
Cat# S6274, SKU# S6274-25ul,
25ul, $97.00
Ask
Alexander M. Loiben, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 10 nM GSK2110183 (AKT1/2/3 inhibitor; Selleck Chemicals #S7521), 1 μM AG-490 (JAK2 inhibitor with effects on EGFR kinase ...
-
No products found
because this supplier's products are not listed.
Christopher J. Black, et al.,
bioRxiv - Neuroscience 2023
Quote:
... A roughly ∼2-4mm craniotomy and 2-3 pilot holes were drilled using a micro drill (Stoelting). Stainless steel screws (000-120 ...
-
No products found
because this supplier's products are not listed.
Lasse Kvich, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... filled to ∼1/3 volume with 2 and 0.1 mm diameter zirconia beads (Biospec, OK, USA) on ice ...
-
No products found
because this supplier's products are not listed.
Athanasios Dimitriadis, et al.,
bioRxiv - Neuroscience 2022
Quote:
... the resulting solution was incubated with 3 volumes of TRI-reagent at room temperature for 2 hours (R2050-1-50; Zymo Research). The mix was then transferred out of the BSL-3 facilities and nucleic acids were purified using the Direct-zol DNA/RNA miniprep kit (R2080 ...
-
No products found
because this supplier's products are not listed.
Zachary Beine, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The primary antibody (2-3% serum, 0.4% PBST, 1:500 Rockland 600-401-379) was applied and incubated for ninety minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Rebecca T. Perelman, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... the 3’-end azide functionalization in presence of 2’-azido-2’-deoxyadenosine-5’triphosphate (ATP-azide, Trilink Biotechnologies) using yeast poly(A ...
-
No products found
because this supplier's products are not listed.
Dorothea O Tilley, et al.,
bioRxiv - Immunology 2021
Quote:
Immunising and screening peptides are outlined in S.Table 2 (Figure 3-figure supplement 2) and were synthesized by Eurogentec (Belgium). A portion was further conjugated to Key Lymphocyte Haemoglutinin (KLH ...
-
No products found
because this supplier's products are not listed.
Trinovita Andraini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 3-(2,4-Dichloro-5-methoxyphenyl)-2-sulfanyl-4(3H)-quinazolinone (BML-CM127-0050, Enzo Life Sciences) was injected at 20mg/kg (in 10% DMSO ...