-
No products found
because this supplier's products are not listed.
Kwok Kin Lee, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) (Promega, Cat. No. G109C) cell viability assay was performed ...
-
No products found
because this supplier's products are not listed.
Yeuklan Poon, Mamie Hui,
bioRxiv - Microbiology 2022
Quote:
... 100 μl of 2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5-Carboxanilide (XTT, 0.5 mg/ml in PBS, Sigma-Aldrich, USA) with 1 μM of menadione (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Güliz Gürel Özcan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and nitro-blue tetrazolium chloride (NBT)/5-bromo-4-chloro-3′-indolyphosphate (BCIP) substrate (Roche) according to published protocols ...
-
No products found
because this supplier's products are not listed.
Jennifer A Rybak, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Treatments were incubated 2 hours before addition of the MTS (3-(4,5-Dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) reagent (Thermo-Fisher Scientific, Waltham, MA) and incubation was continued another 1.5 hours ...
-
No products found
because this supplier's products are not listed.
Annamarie E. Allen, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cells were incubated in treatment media for the indicated period of time and then MTS reagent ((3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) purchased from Abcam, (ab197010 ...
-
No products found
because this supplier's products are not listed.
Ellen M. Bouma, et al.,
bioRxiv - Microbiology 2020
Quote:
Cytotoxicity of the compounds were tested by use of a MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] assay (Merck) at a final MTT concentration of 0.45 mg/ml or by use of a ATPlite Luminescence Assay System (PerkinElmer ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Jaakko Haverinen, Minna Hassinen, Matti Vornanen,
bioRxiv - Physiology 2021
Quote:
... L-364,373 (R-L3 or 5-(2-Fluorophenyl)-1,3-dihydro-3-(1H-indol-3-ylmethyl)-1-methyl-2H-1,4-benzodiazepin-2-one) (Tocris Cookson; Bristol, UK) and mefenamic (dimethylphenylaminobenzoic ...
-
No products found
because this supplier's products are not listed.
Rachid EI Fatimy, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
No products found
because this supplier's products are not listed.
Qing Wei, et al.,
bioRxiv - Microbiology 2020
Quote:
... followed by ExtrAvidin alkaline phosphatase conjugate and alkaline phosphatase substrate: p-nitro blue tetrazolium chloride enhanced 5-bromo-4chloro-3-indolyl phosphate (Bio-Rad). The membranes with the transferred rgp120 were incubated with the HRP-conjugated V5 antibody (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Rayan Khaddaj-Mallat, et al.,
bioRxiv - Neuroscience 2021
Quote:
Pericytes viability was assessed using the 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) assay according to the manufacturer’s procedure (Cell Signaling Technology). Cells were plated at the appropriate concentration in 96-well plates under different experimental conditions ...
-
No products found
because this supplier's products are not listed.
Joshua D. Kerkaert, et al.,
bioRxiv - Microbiology 2021
Quote:
... and 300μL of XTT solution was added to each well (0.5mg/mL XTT [2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide] (VWR) with 25μM menadione in PBS) ...
-
No products found
because this supplier's products are not listed.
Senthil T. Kumar, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 5 mg of 1,2-fioleoyl-sn-glycero-3-phosphoethanolamine (DOPE):1,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS):1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) 5:3:2 w/w (Avanti Polar Lipids) were resuspended in 0.8 mL methanol:chloroform 1:1 ...
-
No products found
because this supplier's products are not listed.
Vasileios Vangalis, et al.,
bioRxiv - Microbiology 2020
Quote:
... the nitro blue tetrazolium chloride (NBT; Cayman Chemical) staining method was used ...
-
No products found
because this supplier's products are not listed.
Khiem C. Lam, Quanyi Chen, Romina S. Goldszmid,
bioRxiv - Immunology 2024
Quote:
Bis-(3’-5’)-cyclic dimeric adenosine monophosphate (c-di-AMP) (#tlrl-nacda, InvivoGen) (see Note 3 ...
-
No products found
because this supplier's products are not listed.
Marco S. Kaiser, et al.,
bioRxiv - Physiology 2021
Quote:
... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Ashley N. Anderson, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... followed by 3 x 5 minute washes in 2 × SSC (BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Kathleen E. McGrath, et al.,
bioRxiv - Cell Biology 2024
Quote:
... IL-3 (5 ng/ml, Peprotech), and cholesterol-rich lipids (40 mg/mL ...
-
No products found
because this supplier's products are not listed.
Evan R. Semenza, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 0.1 mg/mL 2-cyano-6-hydroxybenzothiazole (Santa Cruz). In the case of cultured cells ...
-
No products found
because this supplier's products are not listed.
Yun Deng, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... with 5-bromo-4-chloro-3-indolyl-phosphate nitro blue tetrazolium staining (Vector Laboratories, Burlingame, CA, USA). 10 ∼ 30 embryos were used for each probe ...
-
No products found
because this supplier's products are not listed.
Maria C. Sterrett, et al.,
bioRxiv - Genetics 2022
Quote:
... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
No products found
because this supplier's products are not listed.
Jae-Hyun Yoon, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5 diphenyl tetrazolium bromide (MTT, Corning) was added to each well in the 96-well plates ...
-
No products found
because this supplier's products are not listed.
Buse Baran, et al.,
bioRxiv - Plant Biology 2024
Quote:
... Guide RNA sequences “5-CGUGUCACGACGGAGUGGAU-3” and “5-AUGUUGUAUGUGCCUAUACG-3” were synthesized by GenScript by adding the Cas12a scaffold sequence (5-UAAUUUCUACUCUUGUAGAU-3 ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Valentina Fajner, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... CG42797EcoRI_F: 5’-CCGgaattcATGGAGCCACCAGCT-3’ and CG42797XhoI_R: 5’-TAGAGGTACCctcgagCTACTCAATGCCGAACGTGTTG-3’ and cloned by enzymatic digestion into a pGEX6P1(GE Healthcare).
-
No products found
because this supplier's products are not listed.
Laura Micheli, et al.,
bioRxiv - Neuroscience 2021
Quote:
... PlGF-2 (3 – 30 ng; 5 µl; cat.465-PL/CF, R&D System, USA), VEGF-E (3 – 30 ng ...
-
No products found
because this supplier's products are not listed.
Masahito Yamagata, Wenjun Yan, Joshua R. Sanes,
bioRxiv - Neuroscience 2020
Quote:
... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Addgene)[70] in a ratio of 5:3:2 using polyethylenimine (24765-2, Polysciences). Virus supernatant was harvested 30 h after transfection ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Jin-Woong Heo, et al.,
bioRxiv - Physiology 2023
Quote:
... for 2□min and 3% lead citrate (EMS, 22410) for 1□min ...
-
No products found
because this supplier's products are not listed.
Gaoyang Liang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... A Luna C18(2) C8 column (3 μm, 2 mm × 50 mm, Phenomenex) was used ...
-
No products found
because this supplier's products are not listed.
Dairui Li, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Cells were passaged every 3–5 days with ReLeSR (STEMCELL Technologies). All cells used had a normal diploid karyotype.
-
No products found
because this supplier's products are not listed.
Lillian McGilp, Aaron Semington, Jennifer Kimball,
bioRxiv - Plant Biology 2021
Quote:
... then suspended in a 0.2% solution of 2,3,5 triphenyl tetrazolium chloride (Mp Biomedicals Inc, Santa Ana, CA) for 2 hours ...
-
No products found
because this supplier's products are not listed.
Nioosha Nekooie-Marnany, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Cy-3 or Cy-5 (Jackson Immunoresearch Laboratories), and processed for DAPI or Hoechst staining to visualize cells’ nuclei before mounting in ImmuMount medium (Shandon) ...
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004183,
5 gm, $900.00
Ask
Luke R. Perreault, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Minced tissue underwent 3-5 serial digestions in collagenase type 2 (Worthington Biochemical Corp, Lakewood, NJ) in sterile PBS with 20 mM glucose ...
-
No products found
because this supplier's products are not listed.
Qiao Wen Tan, Emmanuel Tan, Marek Mutwil,
bioRxiv - Plant Biology 2024
Quote:
... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
No products found
because this supplier's products are not listed.
Jennifer Hua, et al.,
bioRxiv - Neuroscience 2022
Quote:
... BML-P137) for 1h and 2h before reading fluorescence (ex 365, em 440) on a plate reader (Flexstation 3, Molecular Devices,). For cathepsin B activity assessment by microscopy ...
-
No products found
because this supplier's products are not listed.
Jennifer S. Chen, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 3 dpi by high content imaging (BioTek Cytation 5) configured with brightfield and GFP cubes ...
-
No products found
because this supplier's products are not listed.
Katharina Best, et al.,
bioRxiv - Biochemistry 2022
Quote:
... R3/3 copper grids with a 2 nm carbon coating (Quantifoil) using a Vitrobot mark IV (FEI ...
-
No products found
because this supplier's products are not listed.
Xin-Miao Zhang, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... B-cell lymphoma-2 associated X protein antibody (Bax, 60267-1-Ig), and cysteinyl aspartate specific puroteinase-3 antibody (Caspase-3, 66470-2-Ig) were purchased from Proteintech (Wuhan, China), and the p53 antibody (Ab131442) ...
-
No products found
because this supplier's products are not listed.
Valentina Gandin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... using the following two primer sequences (T7 Forward: 5’-TAATACGACTCACTATAGCGTCATC-3’; Reverse: 5’-TTGTCGCACGTTCGGTGTCG-3’) and purified with DNA Clean and Concentrator-5 Kit (Zymo Research, 11-302). dsDNA was converted to RNA with HiScribe™ T7 High Yield RNA Synthesis Kit (NEB ...
-
No products found
because this supplier's products are not listed.
Suha Naffar-Abu Amara, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 3 and 5 and counted using a particle counter (Z1; Beckman Coulter, Inc.). Experiments were carried out in triplicate ...
-
No products found
because this supplier's products are not listed.
Christos Georgiadis, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3% human serum (Seralab) +20 ng/ml human recombinant IL-2 (Miltenyi Biotec) and activated with TransAct reagent (Miltenyi Biotec) ...
-
No products found
because this supplier's products are not listed.
Yoichi Araki, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or Spinning disk confocal microscopes controlled by axiovision software (Carl Zeiss; Fig. 2, 3, and 5). Following 5-10 min of baseline recording ...
-
No products found
because this supplier's products are not listed.
Hiroshi Ichise, et al.,
bioRxiv - Immunology 2021
Quote:
... BA685RIF‐3 (Olympus), two dichroic mirrors ...
-
No products found
because this supplier's products are not listed.
Dhiraj Kumar Singh, et al.,
bioRxiv - Immunology 2020
Quote:
... or anti-SARS CoV-2 nucleocapsid (N) antibody (Sino Biologicals, USA, 1:100, 2h at 37°C). Antihuman ACE-2 (R&D Systems ...