-
No products found
because this supplier's products are not listed.
Luisa Saecker, Hanns Häberlein, Sebastian Franken,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... [2-Amino-4-[3-(trifluoromethyl)phenyl]-3-thienyl] phenylmethanone (VCP 171; Tocris, 1018830-99-3), 5-[2-(5-nitro-2-furanyl)ethenyl]-2-furancarboxylic acid ...
-
No products found
because this supplier's products are not listed.
Nagalakshmi Balasubramanian, et al.,
bioRxiv - Neuroscience 2022
Quote:
... pyrazole (Sigma, St ...
-
No products found
because this supplier's products are not listed.
Ryo Kawakami, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 4,4-difluoro-5-(2-thienyl)-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (BODIPY-C12, Invitrogen D3835), was dissolved in 100% ethanol and conjugated to 10% bovine serum albumin ...
-
No products found
because this supplier's products are not listed.
Romain D. Cazé, et al.,
bioRxiv - Neuroscience 2023
Quote:
D-AP5 (D-(−)-2-Amino-5-phosphonopentanoic acid) and SR 95531 (2-(3-Carboxypropyl)-3-amino-6-(4 methoxyphenyl) pyridazinium bromide) were purchased from Abcam, UK ...
-
No products found
because this supplier's products are not listed.
Joschka Hellmeier, et al.,
bioRxiv - Biophysics 2020
Quote:
... and 2% 1,2-dioleoyl-sn-glycero-3-[N(5-amino-1-carboxypentyl)iminodiaceticacid]succinyl[nickel salt] (Ni-DOGS NTA) (Avanti Polar Lipids) were prepared at a total lipid concentration of 0.5mg ml−1 as described 22 in 10x Dulbecco’s phosphate-buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Nitin Wadhwani, et al.,
bioRxiv - Cancer Biology 2022
Quote:
SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
No products found
because this supplier's products are not listed.
Qian Chen, et al.,
bioRxiv - Genomics 2020
Quote:
... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
No products found
because this supplier's products are not listed.
I. Cuella Martin, et al.,
bioRxiv - Microbiology 2024
Quote:
... some plates were prepared with the addition of the redox indicator 2,3-diphenyl-5-(2-thienyl) tetrazolium chloride (STC; Merck, USA) at a final concentration of 50 µg/ml ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
No products found
because this supplier's products are not listed.
Emily C. Britt, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 2-chloro-4,5-difluoro-N-[[[2-methoxy-5-[[(methylamino)carbonyl]amino]phenyl]amino] carbonyl]-benzamide (Cayman Chemical, no. 17578) were used ...
-
No products found
because this supplier's products are not listed.
Xiyu Dong, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 2 mM amino acids (Roche), 1 nM pY71sfGFP plasmid encoding superfolder GFP (M ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Ashley N. Anderson, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... followed by 3 x 5 minute washes in 2 × SSC (BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Yuki Kondo, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 3-amino-9-ethylcarbazole (Vector Laboratories, Inc.) was used as a substrate for visualization ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Claudia Blaurock, et al.,
bioRxiv - Microbiology 2021
Quote:
... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...
-
No products found
because this supplier's products are not listed.
Ferdinand Althammer, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
No products found
because this supplier's products are not listed.
Sunniyat Rahman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
Shohei Yamamoto, et al.,
bioRxiv - Cell Biology 2022
Quote:
... the polystyrene beads containing surface primary amino groups (PolySciences, 17145-5, Diameter 3 μm) were incubated with 10 mM of Sulfo-NHS-LC-LC-Biotin (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Bradley M. Readnour, et al.,
bioRxiv - Microbiology 2021
Quote:
... succinimidyl ester)-LPSXG-(5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid) (Edans) peptides were provided by GenScript (Piscataway, NJ). Six peptide sequences were selected for study ...
-
No products found
because this supplier's products are not listed.
Irene González-Domínguez, et al.,
bioRxiv - Immunology 2022
Quote:
... 5 mL of Nonessential Amino Acid Solution (NEAA, Corning™ MEM, NY, USA), 3 μg/mL puromycin (Invivogen ...
-
No products found
because this supplier's products are not listed.
Stephanie S. Kim, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ...
-
No products found
because this supplier's products are not listed.
Mi Hyun Seo, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and visualized using a 3-amino-9-ethylcarbazole solution (Santa Cruz Biotechnology, USA) with no counter staining ...
-
No products found
because this supplier's products are not listed.
Giorgia Cimato, et al.,
bioRxiv - Microbiology 2024
Quote:
... Staining was done with 3-amino-9-ethylcarbazole (AEC) (BioLegend, Amsterdam, The Netherlands) as HRP substrate ...
-
No products found
because this supplier's products are not listed.
Kathleen E. McGrath, et al.,
bioRxiv - Cell Biology 2024
Quote:
... IL-3 (5 ng/ml, Peprotech), and cholesterol-rich lipids (40 mg/mL ...
-
No products found
because this supplier's products are not listed.
Paul-Lennard Mendez, et al.,
bioRxiv - Genomics 2024
Quote:
... SMAD2/3 (SMAD 2/3 XP, Cell Signaling Technology 8685) or isotype control (Rabbit IgG XP ...
-
No products found
because this supplier's products are not listed.
Alief Moulana, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... we thawed yeast RBD library and the Wuhan Hu-1 and Omicron BA.1 strains by inoculating the corresponding glycerol stocks in SDCAA (6.7 g/L YNB without amino acid [VWR #90004-150], 5 g/L ammonium sulfate [Sigma-Aldrich #A4418], 2% dextrose [VWR #90000– 904] ...
-
No products found
because this supplier's products are not listed.
Valentina Fajner, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... CG42797EcoRI_F: 5’-CCGgaattcATGGAGCCACCAGCT-3’ and CG42797XhoI_R: 5’-TAGAGGTACCctcgagCTACTCAATGCCGAACGTGTTG-3’ and cloned by enzymatic digestion into a pGEX6P1(GE Healthcare).
-
No products found
because this supplier's products are not listed.
Ludovic Enkler, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2% (w/v) glucose and mixtures of amino acids (MP Biomedicals) depending on the auxotrophies used for selection ...
-
No products found
because this supplier's products are not listed.
Aaron R. Cox, et al.,
bioRxiv - Immunology 2020
Quote:
... Glycolytic and TCA intermediates were separated on a Luna Amino (NH2) column (3 µm, 100A 2 × 150 mm, Phenomenex), that was maintained in a temperature-controlled chamber (37°C).
-
No products found
because this supplier's products are not listed.
Maude Jans, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Fixative was removed by washing 5 x 3 min in 0.1 M cacodylate buffer and samples were incubated in 2% osmium (OsO4, EMS) in 0.1 M cacodylate buffer for 30 min at RT ...
-
No products found
because this supplier's products are not listed.
Máté Kiss, et al.,
bioRxiv - Immunology 2020
Quote:
... TSA Cyanine 3 or Cyanine 5 amplification kits (Perkin Elmer) were used according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Valentina Gandin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... using the following two primer sequences (T7 Forward: 5’-TAATACGACTCACTATAGCGTCATC-3’; Reverse: 5’-TTGTCGCACGTTCGGTGTCG-3’) and purified with DNA Clean and Concentrator-5 Kit (Zymo Research, 11-302). dsDNA was converted to RNA with HiScribe™ T7 High Yield RNA Synthesis Kit (NEB ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Jennifer S. Chen, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 3 dpi by high content imaging (BioTek Cytation 5) configured with brightfield and GFP cubes ...
-
No products found
because this supplier's products are not listed.
Dairui Li, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Cells were passaged every 3–5 days with ReLeSR (STEMCELL Technologies). All cells used had a normal diploid karyotype.
-
No products found
because this supplier's products are not listed.
Qiao Wen Tan, Emmanuel Tan, Marek Mutwil,
bioRxiv - Plant Biology 2024
Quote:
... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
No products found
because this supplier's products are not listed.
J. Andrew Duty, et al.,
bioRxiv - Microbiology 2022
Quote:
... Codon optimized SARS-CoV-2 Wuhan Spike carrying the D614G amino acid change (Sino Biological #VG40589-UT(D614G)) was modified to remove the last 21 amino acids at the C-terminus (SpikeΔ21 ...
-
No products found
because this supplier's products are not listed.
Kamal L Nahas, et al.,
bioRxiv - Cell Biology 2021
Quote:
3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ...
-
No products found
because this supplier's products are not listed.
Lei Peng, et al.,
bioRxiv - Immunology 2021
Quote:
... and PepTivator® SARS-CoV-2 Prot_S Complete peptide pool (Miltenyi Biotec, 15 mers with 11 amino acid overlap) covering the entire SARS-CoV-2 S protein ...
-
An aqueous solution with toluene added as a preservative.
Cat# LS002764,
5 mg, $178.00
Ask
Luke R. Perreault, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Minced tissue underwent 3-5 serial digestions in collagenase type 2 (Worthington Biochemical Corp, Lakewood, NJ) in sterile PBS with 20 mM glucose ...
-
No products found
because this supplier's products are not listed.
Nioosha Nekooie-Marnany, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Cy-3 or Cy-5 (Jackson Immunoresearch Laboratories), and processed for DAPI or Hoechst staining to visualize cells’ nuclei before mounting in ImmuMount medium (Shandon) ...
-
No products found
because this supplier's products are not listed.
Dora Pinto, et al.,
bioRxiv - Immunology 2020
Quote:
... His-tagged RBD of SARS-CoV or SARS-CoV-2 was loaded for 5 minutes at 3 μg/ml in KB onto anti-Penta-HIS (HIS1K) biosensors (Molecular Devices, ForteBio). Association of mAbs was performed in KB at 15 μg/ml.
-
No products found
because this supplier's products are not listed.
Yoichi Araki, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or Spinning disk confocal microscopes controlled by axiovision software (Carl Zeiss; Fig. 2, 3, and 5). Following 5-10 min of baseline recording ...
-
No products found
because this supplier's products are not listed.
Suha Naffar-Abu Amara, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 3 and 5 and counted using a particle counter (Z1; Beckman Coulter, Inc.). Experiments were carried out in triplicate ...
-
No products found
because this supplier's products are not listed.
Vaky Abdelsayed, et al.,
bioRxiv - Biophysics 2022
Quote:
... including 2-color and 3-color STORM was performed on an IX83 Inverted microscope (Olympus) using a 100x 1.3NA objective (Olympus) ...
-
No products found
because this supplier's products are not listed.
Wenchao Li, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... SUMO 2/3 (Proteintech, cat. 11251-1-ap, 1:1000 for WB); Ubiquitin (Proteintech ...