-
No products found
because this supplier's products are not listed.
Deniz Kent, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 4-Chloro-2-Methylthiopyrimidine (Sigma, 145289), GW3965 (Sigma ...
-
No products found
because this supplier's products are not listed.
Clara R. Stelman, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
No products found
because this supplier's products are not listed.
Oleg Yarishkin, et al.,
bioRxiv - Cell Biology 2021
Quote:
... CBA (4-chloro-2-[[2-(2-chlorophenoxy) acetyl aminobenzoic acid from Tocris Bioscience (Minneapolis ...
-
No products found
because this supplier's products are not listed.
Nitin Wadhwani, et al.,
bioRxiv - Cancer Biology 2022
Quote:
SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
No products found
because this supplier's products are not listed.
Jingxian Yang, et al.,
bioRxiv - Microbiology 2023
Quote:
... was used for induction of gene expression and X-gal (X-Gal 5-Bromo-4-chloro-3-indolyl-b-D-galactopyranoside; Thermofisher) TSA plates were used for bacterial assessment ...
-
No products found
because this supplier's products are not listed.
Michelle Y Meng, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... 3-[(2-methyl-1,3-thiazol-4-yl)ethynyl]pyridine (MTEP) hydrochloride was purchased from Abcam, and RO4 was a gift from Dr Wendy Winchester.
-
No products found
because this supplier's products are not listed.
Helen M. Gooch, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 4-amino pyridine (5 mM, Merck) and TTX (0.5-1 μM ...
-
No products found
because this supplier's products are not listed.
Axel Guilbaud, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 5’-Ethynyl-2’-deoxycytidine and 5’-chloro-2’- deoxycytidine were obtained from Cayman Chemical Company (Ann Arbor ...
-
No products found
because this supplier's products are not listed.
Yun Deng, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... with 5-bromo-4-chloro-3-indolyl-phosphate nitro blue tetrazolium staining (Vector Laboratories, Burlingame, CA, USA). 10 ∼ 30 embryos were used for each probe ...
-
No products found
because this supplier's products are not listed.
Thomas De Luca, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... anti-eIF2C (Argonaute1-4; clone B-3, 2 μg/mL, cat. no. sc-376696, Santa Cruz Biotechnology), anti-hnRNP A2/B1 (clone b-7 ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Konstadinos Moissoglu, et al.,
bioRxiv - Cell Biology 2020
Quote:
... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Patrick T Griffin, et al.,
bioRxiv - Genomics 2022
Quote:
... and 2 μl of Klenow Fragment (3’→5’ exo-) (M0212L, NEB). The reactions were incubated at 37ºC for 30 minutes and then cleaned up with a Clean and Concentrate-25 column (Zymo) ...
-
No products found
because this supplier's products are not listed.
Dougald M. Monroe, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 4 μM lipid vesicles (Avanti Polar Lipids PS:PC:PE 3:2:5), and FV (0 ...
-
No products found
because this supplier's products are not listed.
Anne D. Villela, et al.,
bioRxiv - Microbiology 2020
Quote:
... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
No products found
because this supplier's products are not listed.
Justin E. Silpe, et al.,
bioRxiv - Microbiology 2021
Quote:
... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Stephanie S. Kim, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ...
-
No products found
because this supplier's products are not listed.
Dillon K. Jarrell, et al.,
bioRxiv - Bioengineering 2020
Quote:
... passage 3-5 AFC were dissociated and resuspended in EGM-2 (Lonza) at 4×105 cells/mL ...
-
No products found
because this supplier's products are not listed.
Sara F. Costa, et al.,
bioRxiv - Microbiology 2023
Quote:
... with 100 μg/mL 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal, VWR), or with 0.1 μM CdCl2 (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
Ashley N. Anderson, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... followed by 3 x 5 minute washes in 2 × SSC (BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Huan Wang, et al.,
bioRxiv - Biochemistry 2021
Quote:
... anti-B cell lymphoma-2 (Bcl-2) (Cell Signaling Technology, USA, #3498S) and anti-CCAAT enhancer binding protein-α (CEBP-α ...
-
No products found
because this supplier's products are not listed.
Angela Armento, et al.,
bioRxiv - Cell Biology 2024
Quote:
... bFGF 5 ng/ml (day 2-4, AF-100-18B, Peprotech), activinA 100 ng/ml (day 4-14 ...
-
No products found
because this supplier's products are not listed.
Sebastian Ströh, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2% and 3% OsO4 (prepared from 2 mL 4% osmium tetroxide solution, Electron Microscopy Sciences, Hatfield, PA)
-
No products found
because this supplier's products are not listed.
Renée M. van der Sluis, et al.,
bioRxiv - Immunology 2021
Quote:
... cells were seeded at 2–3 × 10~4 cells on 6.5 mm Transwell membranes (Corning) coated with 30 μg/mL Bovine type I collagen solution and cultured in 2x P/S (200 U/mL Pen/Strep DMEM-low glycose (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Sangin Kim, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 5-chloro-2ʹ-deoxyuridine (CldU) (#105478) (MP Biomedicals); Shield1 (632189 ...
-
No products found
because this supplier's products are not listed.
Sunniyat Rahman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
No products found
because this supplier's products are not listed.
Abishek Chandrashekar, et al.,
bioRxiv - Microbiology 2022
Quote:
... SARS-CoV-2 (B.1.1.529) RBD proteins (Sino Biological) labeled with APC and DyLight 405 ...
-
No products found
because this supplier's products are not listed.
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Addgene)[70] in a ratio of 5:3:2 using polyethylenimine (24765-2, Polysciences). Virus supernatant was harvested 30 h after transfection ...
-
No products found
because this supplier's products are not listed.
GaYoung Park, et al.,
bioRxiv - Bioengineering 2024
Quote:
... hydrogels of varying Young’s modulus: 5 kPa (4% 20 kDa 4-arm PEG-NB, Creative PEGworks; 2 mM RGD, Genscript), 12 kPa (5% 40 kDa 8-arm PEG-NB ...
-
No products found
because this supplier's products are not listed.
Martineau Éric, et al.,
bioRxiv - Neuroscience 2020
Quote:
... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
No products found
because this supplier's products are not listed.
Paul Renauer, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 4 x 2 mm (Phenomenex). The eluents were A ...
-
No products found
because this supplier's products are not listed.
Masahito Yamagata, Wenjun Yan, Joshua R. Sanes,
bioRxiv - Neuroscience 2020
Quote:
... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
No products found
because this supplier's products are not listed.
Julianna L. Sun, et al.,
bioRxiv - Microbiology 2022
Quote:
... Membranes were developed using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) (Sigma Aldrich, 11697471001. Images were captured using a Nikon Z1000 microscope.
-
No products found
because this supplier's products are not listed.
Mario Mietzsch, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 3.5 μL was applied to a glow-discharged Quantifoil copper grid with 2 nm continuous carbon support over holes (Quantifoil R 2/4 400 mesh), blotted ...
-
No products found
because this supplier's products are not listed.
Luqman O. Awoniyi, et al.,
bioRxiv - Immunology 2023
Quote:
... Primary B cells were isolated from spleens of 2–3 month old C57Bl/6N mice by negative selection with EasySep™ Mouse B Cell Isolation Kit (# 19854, STEMCELL Technologies).
-
No products found
because this supplier's products are not listed.
Yuting Wang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 2-3 months old male young (Jackson Lab #00664) or 2-3 months old GFP+ male young (Jackson Lab #006567 ...
-
No products found
because this supplier's products are not listed.
Zhihui Liu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... with patch pipettes (2-3 MΩ) pulled from borosilicate pipettes (TW150-4, WPI, USA) using PC-10 puller (Narishige ...
-
No products found
because this supplier's products are not listed.
Tim Lüddecke, et al.,
bioRxiv - Zoology 2020
Quote:
... The protein pellet was redissolved in 260 μl lysis buffer (6 M urea, 2 M thiourea, 4% CHAPS, 30 mM DTT, and GE Healthcare 2% IPG buffer pH 3–10). GE Healthcare IEF strips (pH 3–10NL ...
-
No products found
because this supplier's products are not listed.
Nicolò Mangraviti, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and 5 ng/ml human FGF-2 (Miltenyi Biotec). Then ...
-
No products found
because this supplier's products are not listed.
Paolo Mesén-Ramírez, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 200 mM hypoxanthine and 2-5% fresh human RBCs (B+; provided by Universität Klinikum Eppendorf, Hamburg). Cultures were maintained at 37 °C ...
-
No products found
because this supplier's products are not listed.
Elisa Vaiani, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... inhibin B and AMH/MIS by 2-site ELISA (Beckman Coulter and Beckman Coulter Gen II ...
-
No products found
because this supplier's products are not listed.
Walden Li, Ryan M. Wyllie, Paul A. Jensen,
bioRxiv - Microbiology 2020
Quote:
... Strains carrying the pLacZ plasmid appear blue when plated on 0.008% X-gal (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Zymo Research, CA, USA). X-gal concentrations above 0.008% appear to inhibit growth of S ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Ke Xu, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... rabbit anti-B-cell lymphoma-2 (BCL-2) polyclonal antibody (1:1,000 dilution, 26593-1-AP, Proteintech, Rosemont, IL, USA) and mouse anti-GAPDH monoclonal antibody (1:10,000 dilution ...
-
No products found
because this supplier's products are not listed.
Steven Tau, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Plates were imaged every 3-4 d on a Cytation 5 (BioTek) with 4x magnification and phase contrast ...
-
No products found
because this supplier's products are not listed.
Yili Zhang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Intracellular recordings from MNs were made with 10-20 MΩ sharp electrodes filled with 3 M potassium acetate connected to an Axoclamp 2-B amplifier (Molecular Devices). Data acquisition and analyses of resting potential ...
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... Cortical layers 2/3 and 4 neurons were visualized by using an upright microscope and camera system (BX51WIF, Olympus, and SciCam Pro CCD camera ...
-
No products found
because this supplier's products are not listed.
Dessislava Malinova, et al.,
bioRxiv - Immunology 2020
Quote:
... for mouse splenic B cells and goat F(ab’)2 anti-human Fc5μ (Jackson Immunoresearch) for Ramos and DG75 cells ...