-
No products found
because this supplier's products are not listed.
Zongyu Li, et al.,
bioRxiv - Physiology 2023
Quote:
... glycogen phosphorylase was inhibited by IV (jugular vein) injection of 1-(3-(3-(2-Chloro-4,5-difluorobenzoyl)ureido)-4-methoxyphenyl)-3-methylurea (Sigma, 5 mg/kg) one hour prior to the start of a tracer infusion ...
-
No products found
because this supplier's products are not listed.
Clara R. Stelman, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
No products found
because this supplier's products are not listed.
Stephen D. Glasgow, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 1-[2-(4-Methoxyphenyl)-2-[3-(4-methoxyphenyl)propoxy]ethyl-1H-imidazole hydrochloride (SKF-96365; 1147, Tocris) in ddH20 ...
-
No products found
because this supplier's products are not listed.
Pojeong Park, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 4-(3-(cyclopentyloxy)-4-methoxyphenyl)pyrrolidin-2-one (rolipram; Abcam); 4-[(2S)-2-[(5-isoquinolinylsulfonyl)methylamino]-3-oxo-3-(4-phenyl-1-piperazinyl)propyl] phenyl isoquinolinesulfonic acid ester (KN-62 ...
-
No products found
because this supplier's products are not listed.
Katherine M. Oliver, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
No products found
because this supplier's products are not listed.
Gabriel A. Yette, Scott Stewart, Kryn Stankunas,
bioRxiv - Developmental Biology 2021
Quote:
... and 175 μg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Promega). Reactions were stopped with three PBS rinses ...
-
No products found
because this supplier's products are not listed.
Valeria Scagliotti, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP, 11383221001, Merck-SIGMA). Sections were mounted using DPX (6522 ...
-
No products found
because this supplier's products are not listed.
Yuishin Kosaka, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... The deletion of the lacZ gene was verified using blue-white selection on an LB agar plate containing 0.1 mM isopropyl-β-D-thiogalactopyranoside (Nacalai Tesque) and 4.0 × 10−3 % 5-bromo-4-chloro-3-indolyl-β-D-galactoside (Takara Bio).
-
No products found
because this supplier's products are not listed.
Yuanyuan Wang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
No products found
because this supplier's products are not listed.
Elias Adriaenssens, et al.,
bioRxiv - Cell Biology 2024
Quote:
... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798; RRID:Addgene_223799 ...
-
No products found
because this supplier's products are not listed.
Dougald M. Monroe, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 4 μM lipid vesicles (Avanti Polar Lipids PS:PC:PE 3:2:5), and FV (0 ...
-
No products found
because this supplier's products are not listed.
Melanie Werner-Klein, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Alkaline phosphatase was developed with 5-bromo-4-chloro-3-indolyl phosphate and Nitroblue tetrazolium (BCIP/NBT; BioRad, Germany) as substrate ...
-
No products found
because this supplier's products are not listed.
Balbina J. Plotkin, Ira M. Sigar, Amber Kaminski,
bioRxiv - Cell Biology 2021
Quote:
... P-(4-Methoxyphenyl)-P-4-morpholinyl-phosphinodithioic acid (GYY4137; 400μM; Cayman Chemical), pyridoxal phosphate (PLP ...
-
No products found
because this supplier's products are not listed.
Mei Hong Liu, et al.,
bioRxiv - Genomics 2023
Quote:
... 3 µL 10x NEBuffer 4 (NEB), 3 µL of 1 mM each dATP/ddCTP/ddGTP/ddTTP (dATP/ddBTP ...
-
No products found
because this supplier's products are not listed.
Paul-Lennard Mendez, et al.,
bioRxiv - Genomics 2024
Quote:
... SMAD2/3 (SMAD 2/3 XP, Cell Signaling Technology 8685) or isotype control (Rabbit IgG XP ...
-
No products found
because this supplier's products are not listed.
Amandine Jarysta, Basile Tarchini,
bioRxiv - Developmental Biology 2021
Quote:
rabbit anti-GNAI1/2/3 (Santa Cruz; sc-262 ...
-
No products found
because this supplier's products are not listed.
Emily J. Talbot, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
No products found
because this supplier's products are not listed.
Alberto Herrera, et al.,
bioRxiv - Immunology 2024
Quote:
... #3 and #4 (Biolegend) were spiked into individual samples ...
-
No products found
because this supplier's products are not listed.
Suzanne M Johnson, et al.,
bioRxiv - Cell Biology 2020
Quote:
EVs were immobilised onto ACLAR (poly-chloro-tri-fluoro-ethylene (PCTFE) film) coated with CellTak (Corning: cat 354240) and fixed with glutaraldehyde in sodium cacodylate buffer (pH 7.2 ...
-
No products found
because this supplier's products are not listed.
Erik P. Hughes, et al.,
bioRxiv - Immunology 2024
Quote:
... Flow cytometry samples were profiled using a BD Fortessa (BD Biosciences, Fig. 2, 3, 4) or an Aurora spectral flow cytometer (Cytek ...
-
No products found
because this supplier's products are not listed.
Sara F. Costa, et al.,
bioRxiv - Microbiology 2023
Quote:
... with 100 μg/mL 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal, VWR), or with 0.1 μM CdCl2 (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Yun Deng, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... with 5-bromo-4-chloro-3-indolyl-phosphate nitro blue tetrazolium staining (Vector Laboratories, Burlingame, CA, USA). 10 ∼ 30 embryos were used for each probe ...
-
No products found
because this supplier's products are not listed.
Lulu Huang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... BMP-2/4) (ERB medium)3 or adding 10 ng/ml human IL-22 (Peprotech) in WENRA4 (Wnt/ R-spondin1 ...
-
No products found
because this supplier's products are not listed.
Margarita Anisimova, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The patch electrodes (3-4 MΩ, World Precision Instruments; 1B150F-3) were filled with intracellular solution containing ...
-
No products found
because this supplier's products are not listed.
Konstantinos Sofiadis, et al.,
bioRxiv - Genomics 2020
Quote:
... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Sebastian Ströh, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2% and 3% OsO4 (prepared from 2 mL 4% osmium tetroxide solution, Electron Microscopy Sciences, Hatfield, PA)
-
No products found
because this supplier's products are not listed.
Rebecca E Schmitt, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Passaging occurred every 3-4 days using ReLeSR (STEMCELL Technologies) and DPBS 1X (Gibco ...
-
No products found
because this supplier's products are not listed.
Aaron Scholl, et al.,
bioRxiv - Genomics 2024
Quote:
... M anti-DENV NS1 (Type 2/3/4) (Cat# MAB94441-100, R&D Systems), M anti-NXT1 (Cat#67680-1-Ig ...
-
No products found
because this supplier's products are not listed.
Sina Ibne Noor, et al.,
bioRxiv - Biochemistry 2020
Quote:
... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Hiroaki Takebe, et al.,
bioRxiv - Microbiology 2024
Quote:
... version 3 (2×300 bp read length; Illumina), following to the manufacturer’s instruction.
-
No products found
because this supplier's products are not listed.
Yuting Wang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 2-3 months old male young (Jackson Lab #00664) or 2-3 months old GFP+ male young (Jackson Lab #006567 ...
-
No products found
because this supplier's products are not listed.
Masahito Yamagata, Wenjun Yan, Joshua R. Sanes,
bioRxiv - Neuroscience 2020
Quote:
... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
No products found
because this supplier's products are not listed.
Marta E. Stremska, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 μm (#19118-2; Polysciences) or 6 μm (#17145-4 ...
-
No products found
because this supplier's products are not listed.
Tulika Singh, et al.,
bioRxiv - Immunology 2021
Quote:
... CD38 APC-AF700 (clone LS198-4-3; Beckman Coulter), CD19 APC-Cy7 (clone SJ25C1 ...
-
No products found
because this supplier's products are not listed.
Ilya Chuykin, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 4-16-cell embryos were transferred to 3 % Ficoll (GE Healthcare) in 0.6x MMR and injected with 5-10 nl of a solution containing mRNAs and/or MOs ...
-
No products found
because this supplier's products are not listed.
Julianna L. Sun, et al.,
bioRxiv - Microbiology 2022
Quote:
... Membranes were developed using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) (Sigma Aldrich, 11697471001. Images were captured using a Nikon Z1000 microscope.
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004183,
5 gm, $900.00
Ask
Faten A. Sayed, et al.,
bioRxiv - Neuroscience 2020
Quote:
... incubated with 3% collagenase type 3 (Worthington), 3 U/ml dispase (Worthington ...
-
No products found
because this supplier's products are not listed.
Katharina Best, et al.,
bioRxiv - Biochemistry 2022
Quote:
... R3/3 copper grids with a 2 nm carbon coating (Quantifoil) using a Vitrobot mark IV (FEI ...
-
No products found
because this supplier's products are not listed.
Xin-Miao Zhang, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... B-cell lymphoma-2 associated X protein antibody (Bax, 60267-1-Ig), and cysteinyl aspartate specific puroteinase-3 antibody (Caspase-3, 66470-2-Ig) were purchased from Proteintech (Wuhan, China), and the p53 antibody (Ab131442) ...
-
No products found
because this supplier's products are not listed.
Qiao Wen Tan, Emmanuel Tan, Marek Mutwil,
bioRxiv - Plant Biology 2024
Quote:
... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
No products found
because this supplier's products are not listed.
Valentina Salvi, et al.,
bioRxiv - Immunology 2021
Quote:
... and PE-conjugated anti-IL-4 (clone 7A3-3, Miltenyi Biotec) following the manufacturer’s recommendations ...
-
No products found
because this supplier's products are not listed.
Corey M. Griffith, et al.,
bioRxiv - Biochemistry 2024
Quote:
... non-targeting sgRNA (TGCTTTACCGCGTTGGGTAA) or CLYBL targeting sgRNA (exon 2: CATAGAGCACTGCTCTCCGG; exon 3: AGACTTTGACCTGGGCACAA; exon 4: CCATTGCAGTCTCCACAAAG) were purchased from Genscript. Plasmids were transformed into OneShot™ E ...
-
No products found
because this supplier's products are not listed.
Piyush Daga, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4% (3-Aminopropyl)triethoxysilane(APTES)-treated and 2% glutaraldehyde-activated glass-bottom dishes (Ibidi) were used to cast polyacrylamide (PAA ...
-
No products found
because this supplier's products are not listed.
Steven Tau, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Plates were imaged every 3-4 d on a Cytation 5 (BioTek) with 4x magnification and phase contrast ...
-
No products found
because this supplier's products are not listed.
Richard B Crouse, et al.,
bioRxiv - Neuroscience 2020
Quote:
... blocked for 2-3 hours (0.3% Triton X-100, American Bioanalytical, Canton, MA; 3% normal donkey serum, Jackson ImmunoResearch, West Grove, PA), then incubated overnight with primary antibodies (1:1000 + 1% normal donkey serum) ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Lara Taniguchi, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Borosilicate glass pipettes (3–4 MΩ, Molecular Devices) filled with internal solution (295–305 mOsm ...
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... Cortical layers 2/3 and 4 neurons were visualized by using an upright microscope and camera system (BX51WIF, Olympus, and SciCam Pro CCD camera ...
-
No products found
because this supplier's products are not listed.
Yali Zhang, et al.,
bioRxiv - Microbiology 2020
Quote:
... SARS-CoV2-S1 (Sino Biological, 40591-V08H, n=3) and SARS-CoV2-S2 (Sino Biological ...