-
No products found
because this supplier's products are not listed.
Chao-Chieh Lin, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
No products found
because this supplier's products are not listed.
Chao-Chieh Lin, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
No products found
because this supplier's products are not listed.
Benjamin C. Shaw, et al.,
bioRxiv - Molecular Biology 2022
Quote:
The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
No products found
because this supplier's products are not listed.
Shuhei Yoshida, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 1 mM adenosine 5’-O-(3-thiotriphosphate) (ATPγS, ab138911, abcam) was used instead of ATP for the kinase reaction ...
-
No products found
because this supplier's products are not listed.
Clara Ortega-de San Luis, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9 ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
No products found
because this supplier's products are not listed.
Francesca De Angelis Rigotti, et al.,
bioRxiv - Pathology 2022
Quote:
... (Cell Signaling 15019S, 1:5) and then with diluted anti-αSMA-Cy3 antibody (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Yuhao Li, et al.,
bioRxiv - Microbiology 2023
Quote:
... CD4(Biolegend, RM4-5, 1:400), CD62L (Biolegend ...
-
No products found
because this supplier's products are not listed.
Ying Ru, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... CD34 (BD Biosciences, 560940, 1/5), and retention of marker CD105 positivity and CD45 negativity as well.
-
No products found
because this supplier's products are not listed.
Raquel V. Mendes, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... FGF7 (5 ng·mL-1, Peprotech), FGF10 (20 ng·mL-1 ...
-
No products found
because this supplier's products are not listed.
Emma J. van Bodegraven, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... An overnight blunt ligation was induced for the 5’ of exon 1 and the 3’ of exon 3 (5 U T4 DNA ligase (Roche, Basel, Switzerland)) at room temperature ...
-
No products found
because this supplier's products are not listed.
Fushun Wang, et al.,
bioRxiv - Neuroscience 2021
Quote:
... N-(piperidin-1-yl)-5-(4-iodophenyl)-1-(2,4-dichlorophenyl)-4-methyl-1H-pyrazole-3-carboxamide (AM251, 5 µM, Tocris); Tetrodotoxin (TTX ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Neta Erez, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
No products found
because this supplier's products are not listed.
Irene Julca, et al.,
bioRxiv - Plant Biology 2022
Quote:
... The medium was aspirated and fresh medium containing 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, premixed in 5:1 ratio, Promega) was added to the treated cells ...
-
No products found
because this supplier's products are not listed.
Lisa Weixler, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... anti-tubulin 1:5000 (B-5-1-2 Santa Cruz). For slot blotting ...
-
No products found
because this supplier's products are not listed.
Mellisa Xie, et al.,
bioRxiv - Genetics 2022
Quote:
... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
No products found
because this supplier's products are not listed.
Ikumi Mizuno, et al.,
bioRxiv - Neuroscience 2021
Quote:
... SR141716 (1, 5 mg/kg) (Cayman Chemicals) was dissolved in saline with 5% DMSO and 0.1% Tween 20 ...
-
No products found
because this supplier's products are not listed.
Michihisa Kono, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... with dispase (1:5, Corning), Fungizone (1:500 ...
-
No products found
because this supplier's products are not listed.
Shayne E. Quinn, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and 5 μg·ml−1 plasmocin (Invivogen) maintained at 37°C with 7.5% CO2.
-
No products found
because this supplier's products are not listed.
Umit Akkose, et al.,
bioRxiv - Genomics 2020
Quote:
... and 1 μCi of [α-32P]-3’-deoxyadenosine 5’-triphosphate (cordycepin 5’-triphosphate, Perkin Elmer Life Sciences) in 1× terminal deoxynucleotidyl transferase buffer (New England Biolabs) ...
-
No products found
because this supplier's products are not listed.
Hua Li, et al.,
bioRxiv - Cell Biology 2020
Quote:
... was amplified by PCR using the primers (5’-GGTTCCGCGTGGATCCATGTCTCATGCAGCCGAGCCA-3’ and 5’-GGAATTCCGGGGATCCTCAGGACTCCTCTTCAATGCTGA-3’) and cloned into BamHI site of pGEX-4T-1 expression vector (GE Healthcare) using In-Fusion HD Cloning System (Clontech) ...
-
No products found
because this supplier's products are not listed.
Maiko Kawasaki, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... KRT1-5 (14309-1-AP ; Proteintech), Prdm16 (AF6295 ...
-
No products found
because this supplier's products are not listed.
Biao Qiu, Olga Boudker,
bioRxiv - Biophysics 2024
Quote:
... 4 mg/ml liposomes comprising 5:5:2 (w:w) 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC, Avanti Polar Lipids), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Xavier Rovira-Clavé, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 5 μL PEI (Polysciences, #23966-1) in 50 μL Opti-MEM (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Tyler Wallace, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Sections were rinsed in PBS (5 x 5 min) followed by a 1 hour incubation in Vectastain ABC Solution (1:1,000; Vector Laboratories). Sections were rinsed again prior to incubation in diaminobenzidine and hydrogen peroxide (0.02% diaminobenzidine/0.09% hydrogen peroxide in KPBS ...
-
No products found
because this supplier's products are not listed.
Coralie Hérent, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Cy-3 or Cy-5 (1:500, Jackson ImmunoResearch). Sections were counterstained with a fluorescent Nissl stain (NeuroTrace 435/445 blue ...
-
No products found
because this supplier's products are not listed.
Bart Theeuwes, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... EBs were split 1:3 in SF-D media containing recombinant human (rh) VEGF (5 ng ml-1; R&D Systems), rhBMP4 (10 ng ml-1 ...
-
No products found
because this supplier's products are not listed.
Rachel Anderson, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... then neutralized with 1 μL 5 M HCl (VWR BDH7419-1). The remainder of the library preparation was performed according to the xGen protocol except that post-ligation ...
-
No products found
because this supplier's products are not listed.
Marco S. Kaiser, et al.,
bioRxiv - Physiology 2021
Quote:
... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
No products found
because this supplier's products are not listed.
Maryam Ghaderi Najafabadi, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 5 mg ml-1 dispase (STEMCELL Technologies) and 1 mg ml-1 DNAse (Sigma ...
-
No products found
because this supplier's products are not listed.
Basma A. Yasseen, et al.,
bioRxiv - Immunology 2023
Quote:
... Images were acquired (1-5 images per subject) using the Cytation 5 Cell Imaging MultiMode Reader (Agilent). Images were processed to quantify fluorescence intensity using Gen5 software package 3.08.
-
No products found
because this supplier's products are not listed.
Buse Baran, et al.,
bioRxiv - Plant Biology 2024
Quote:
... Guide RNA sequences “5-CGUGUCACGACGGAGUGGAU-3” and “5-AUGUUGUAUGUGCCUAUACG-3” were synthesized by GenScript by adding the Cas12a scaffold sequence (5-UAAUUUCUACUCUUGUAGAU-3 ...
-
No products found
because this supplier's products are not listed.
Cole B. Matrishin, et al.,
bioRxiv - Microbiology 2022
Quote:
... 5 μL of 1% uranyl acetate in water (Electron Microscopy Sciences 22400-1) was added to the grid ...
-
No products found
because this supplier's products are not listed.
Valentina Gandin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... using the following two primer sequences (T7 Forward: 5’-TAATACGACTCACTATAGCGTCATC-3’; Reverse: 5’-TTGTCGCACGTTCGGTGTCG-3’) and purified with DNA Clean and Concentrator-5 Kit (Zymo Research, 11-302). dsDNA was converted to RNA with HiScribe™ T7 High Yield RNA Synthesis Kit (NEB ...
-
No products found
because this supplier's products are not listed.
Ryley Collard, et al.,
bioRxiv - Neuroscience 2022
Quote:
... CD-1 (5-7 weeks old, Charles River Laboratories, Kingston, NY, USA), and CF-1 (5-7 weeks old ...
-
No products found
because this supplier's products are not listed.
LK. Debarba, et al.,
bioRxiv - Physiology 2020
Quote:
... 1% Antibiotic-Antimycotic] in a 5% CO2 incubator (Galaxy 170R, Eppendorf) at 37°C ...
-
No products found
because this supplier's products are not listed.
Richard Nelson Hall, et al.,
bioRxiv - Bioengineering 2022
Quote:
Luminescence was measured on a plate reader (BioTek Synergy™ HTX for collecting data presented in Figures 1, 3, 5, S5, S8, S12, S14; BioTek Synergy™ Neo2 for Figures 2C-D ...
-
No products found
because this supplier's products are not listed.
Tianfang Yang, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... anti-Nkx2-5 (AF2444, Novus Biologicals; 1:200), anti-Cx40 (Cx40-A ...
-
No products found
because this supplier's products are not listed.
Lih-Yun Hsu, et al.,
bioRxiv - Immunology 2023
Quote:
... human TGFβ-1 (5 ng/ml, Miltenyi Biotec), anti-mouse IL-4 (11B11 ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Charlotte Jaloux, et al.,
bioRxiv - Neuroscience 2022
Quote:
... anti-CD90 (IM1839U / Beckman Coulter / F15-42-1-5), anti-CD146 (A07483 / Beckman Coulter / TEA1-34) ...
-
No products found
because this supplier's products are not listed.
Catarina Nascimento, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... diluted in Novolink DAB Substrate Buffer (Leica Biosystems, 1:20, 5 min). Finally ...
-
No products found
because this supplier's products are not listed.
Annelot C. M. van Esbroeck, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... After rinsing the membrane with TBS-T (3 × 5 min) and TBS (3 × 5 min) fluorescence was detected by scanning on the Odyssey CLx (LI-COR Biosciences).
-
No products found
because this supplier's products are not listed.
R. Dilshan Malewana, et al.,
bioRxiv - Immunology 2023
Quote:
... was applied for 5 min (1:2000, GeneTex, GTX135357). To minimize the background ...
-
No products found
because this supplier's products are not listed.
André-Claude Mbouombouo Mfossa, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and QKI-5 (A300-183A, Bethyl Laboratories, 1/5000), followed by 45 min incubation with the appropriate HRP-conjugated antibodies (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Nina R. Montoya, et al.,
bioRxiv - Microbiology 2022
Quote:
... The plates were developed with TMB (3, 3’, 5, 5’ - Tetramethylbenzidine) ELISA Peroxidase Substrate (Rockland Immunochemical, Limerick, PA), and absorbance was measured on a plate reader at 655 nm.
-
No products found
because this supplier's products are not listed.
Rong Yang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 5 μg total RNA was incubated with 1 μg m6A polyclonal antibody (Synaptic Systems# 202003)(41 ...
-
No products found
because this supplier's products are not listed.
Jia Li, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and NEMO (excitation: 490 ± 5 nm; emission: 520 ± 5 nm) fluorescence were measured with a Flexstation 3 microplate reader (Molecular Devices, USA) controlled by SoftMax Pro v7.x ...