-
No products found
because this supplier's products are not listed.
Aashutosh Vihani, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 1% 2-ethyl-3-methylpyrazine (Sigma W315508), 1% 2,5-dimethylpyrazine (Sigma 17542015) ...
-
No products found
because this supplier's products are not listed.
James Pelletier, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 micromols sodium sulfo-NHS and 5 micromols 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (Thermo Fisher #22980) in 10 μL of DMSO ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Patrick C. Kerstein, et al.,
bioRxiv - Neuroscience 2020
Quote:
... (S)-1-(2-Amino-2-carboxyethyl)-3-(2-carboxy-5-phenylthiophene-3-yl-methyl)-5-methylpyrimidine-2,4-dione (ACET; 1μM; Tocris Bioscience, catalog #2728).
-
No products found
because this supplier's products are not listed.
Nitin Wadhwani, et al.,
bioRxiv - Cancer Biology 2022
Quote:
SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
No products found
because this supplier's products are not listed.
Rachid EI Fatimy, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Annamarie E. Allen, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cells were incubated in treatment media for the indicated period of time and then MTS reagent ((3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) purchased from Abcam, (ab197010 ...
-
No products found
because this supplier's products are not listed.
Neta Erez, et al.,
bioRxiv - Cell Biology 2020
Quote:
E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
No products found
because this supplier's products are not listed.
Xinjian Yu, et al.,
bioRxiv - Genomics 2024
Quote:
... included 1.11 μM N7XX (5′-CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTCTCGTGGGCTCGG-3′) and S5XX (5′-AATGATACGGCGACCACCGAGATCTACACXXXXXXXXTCGTCGGCAGCGTC-3′) primers (384PP_AQBP) in 2× HiFi HotStart ReadyMix (Roche, KK2602, 6RES_GPSA). Dual barcode sequences in primers are denoted by “XXXXXXXX.” Unique dual barcode combinations for each well of a 384-well plate were achieved by dispensing 16 unique N7XX barcodes across each row and 24 unique S5XX barcodes across each column ...
-
No products found
because this supplier's products are not listed.
Qinqin Fei, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... 1,2-dipalmitoyl-sn-glycero-3-phospho((ethyl-1’,2’,3’-triazole)triethyleneglycolmannose) (ammonium salt) (PA-PEG3-mannose) were purchased from Avanti Polar Lipids (Alabaster, AL, USA). Linoleic acid (LA) ...
-
No products found
because this supplier's products are not listed.
Marco S. Kaiser, et al.,
bioRxiv - Physiology 2021
Quote:
... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
No products found
because this supplier's products are not listed.
Jana Hucklenbroich, et al.,
bioRxiv - Plant Biology 2021
Quote:
... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
Ashley N. Anderson, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... followed by 3 x 5 minute washes in 2 × SSC (BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Minjie Hong, et al.,
bioRxiv - Cell Biology 2024
Quote:
... we chemically mutagenized the mCherry::DIS-3 strain by ethyl methanesulfonate (EMS), followed by a clonal screen ...
-
No products found
because this supplier's products are not listed.
Paul-Lennard Mendez, et al.,
bioRxiv - Genomics 2024
Quote:
... SMAD2/3 (SMAD 2/3 XP, Cell Signaling Technology 8685) or isotype control (Rabbit IgG XP ...
-
No products found
because this supplier's products are not listed.
Kathleen E. McGrath, et al.,
bioRxiv - Cell Biology 2024
Quote:
... IL-3 (5 ng/ml, Peprotech), and cholesterol-rich lipids (40 mg/mL ...
-
No products found
because this supplier's products are not listed.
Patricia Bilodeau, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5’-ATAAGCTCCCTGCCCGAGTC-3’ (Santa Cruz sc-430739).
-
No products found
because this supplier's products are not listed.
Stephanie S. Kim, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ...
-
No products found
because this supplier's products are not listed.
Maria C. Sterrett, et al.,
bioRxiv - Genetics 2022
Quote:
... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
No products found
because this supplier's products are not listed.
Juan Qin, et al.,
bioRxiv - Biochemistry 2021
Quote:
... PKAc was immobilized via standard N-hydroxysuccinimide (NHS) / 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) amine coupling on a CM5 (carboxyl methyl dextran) sensor chip (GE Healthcare). Before covalent immobilization of PKAc ...
-
No products found
because this supplier's products are not listed.
Ahmed M. Fahmy, et al.,
bioRxiv - Immunology 2023
Quote:
... 2’’3’’-cGAMP ELISA was done using the 2’’3’’-cGAMP ELISA Kit (Cayman Chemical Co.) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Buse Baran, et al.,
bioRxiv - Plant Biology 2024
Quote:
... Guide RNA sequences “5-CGUGUCACGACGGAGUGGAU-3” and “5-AUGUUGUAUGUGCCUAUACG-3” were synthesized by GenScript by adding the Cas12a scaffold sequence (5-UAAUUUCUACUCUUGUAGAU-3 ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Mark A. Rutherford, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-diaminobenzidine plus nickel (DAB; Vector Laboratories Kit; 2-5 min reaction). Sections were analyzed with an Olympus BX51 upright microscope ...
-
No products found
because this supplier's products are not listed.
Gina Partipilo, et al.,
bioRxiv - Bioengineering 2024
Quote:
... disodium;4-[3-pyridin-2-yl-6-(4- sulfonatophenyl)-1,2,4-triazin-5-yl]benzenesulfonate hydrate (Ferrozine, VWR) All media components were autoclaved or sterilized using 0.2 μm PES filters.
-
No products found
because this supplier's products are not listed.
Yu H. Sun, et al.,
bioRxiv - Genomics 2020
Quote:
... This mixture was aliquoted in 2-3 cryovials (Corning, NY), secured on an aluminum cryocane ...
-
No products found
because this supplier's products are not listed.
Máté Kiss, et al.,
bioRxiv - Immunology 2020
Quote:
... TSA Cyanine 3 or Cyanine 5 amplification kits (Perkin Elmer) were used according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Addgene)[70] in a ratio of 5:3:2 using polyethylenimine (24765-2, Polysciences). Virus supernatant was harvested 30 h after transfection ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004183,
5 gm, $900.00
Ask
Luke R. Perreault, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Minced tissue underwent 3-5 serial digestions in collagenase type 2 (Worthington Biochemical Corp, Lakewood, NJ) in sterile PBS with 20 mM glucose ...
-
No products found
because this supplier's products are not listed.
Gaoyang Liang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... A Luna C18(2) C8 column (3 μm, 2 mm × 50 mm, Phenomenex) was used ...
-
No products found
because this supplier's products are not listed.
Dairui Li, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Cells were passaged every 3–5 days with ReLeSR (STEMCELL Technologies). All cells used had a normal diploid karyotype.
-
No products found
because this supplier's products are not listed.
Katharina Best, et al.,
bioRxiv - Biochemistry 2022
Quote:
... R3/3 copper grids with a 2 nm carbon coating (Quantifoil) using a Vitrobot mark IV (FEI ...
-
No products found
because this supplier's products are not listed.
Nioosha Nekooie-Marnany, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Cy-3 or Cy-5 (Jackson Immunoresearch Laboratories), and processed for DAPI or Hoechst staining to visualize cells’ nuclei before mounting in ImmuMount medium (Shandon) ...
-
No products found
because this supplier's products are not listed.
Qiao Wen Tan, Emmanuel Tan, Marek Mutwil,
bioRxiv - Plant Biology 2024
Quote:
... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
No products found
because this supplier's products are not listed.
Jennifer S. Chen, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 3 dpi by high content imaging (BioTek Cytation 5) configured with brightfield and GFP cubes ...
-
No products found
because this supplier's products are not listed.
Xin-Miao Zhang, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... B-cell lymphoma-2 associated X protein antibody (Bax, 60267-1-Ig), and cysteinyl aspartate specific puroteinase-3 antibody (Caspase-3, 66470-2-Ig) were purchased from Proteintech (Wuhan, China), and the p53 antibody (Ab131442) ...
-
No products found
because this supplier's products are not listed.
Reimi Tada, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Tadpoles and froglets anesthetized with 0.025% or 0.05% ethyl-3-aminobenzoate were observed under a fluorescence stereomicroscope (Nikon SMZ18) with a 0.5x objective lens using a GFP longpass filter (if in a fluorescent view ...
-
No products found
because this supplier's products are not listed.
Dora Pinto, et al.,
bioRxiv - Immunology 2020
Quote:
... His-tagged RBD of SARS-CoV or SARS-CoV-2 was loaded for 5 minutes at 3 μg/ml in KB onto anti-Penta-HIS (HIS1K) biosensors (Molecular Devices, ForteBio). Association of mAbs was performed in KB at 15 μg/ml.
-
No products found
because this supplier's products are not listed.
Christos Georgiadis, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3% human serum (Seralab) +20 ng/ml human recombinant IL-2 (Miltenyi Biotec) and activated with TransAct reagent (Miltenyi Biotec) ...
-
No products found
because this supplier's products are not listed.
Valentina Gandin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... using the following two primer sequences (T7 Forward: 5’-TAATACGACTCACTATAGCGTCATC-3’; Reverse: 5’-TTGTCGCACGTTCGGTGTCG-3’) and purified with DNA Clean and Concentrator-5 Kit (Zymo Research, 11-302). dsDNA was converted to RNA with HiScribe™ T7 High Yield RNA Synthesis Kit (NEB ...
-
No products found
because this supplier's products are not listed.
Yoichi Araki, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or Spinning disk confocal microscopes controlled by axiovision software (Carl Zeiss; Fig. 2, 3, and 5). Following 5-10 min of baseline recording ...
-
No products found
because this supplier's products are not listed.
Hiroshi Ichise, et al.,
bioRxiv - Immunology 2021
Quote:
... BA685RIF‐3 (Olympus), two dichroic mirrors ...
-
No products found
because this supplier's products are not listed.
Suha Naffar-Abu Amara, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 3 and 5 and counted using a particle counter (Z1; Beckman Coulter, Inc.). Experiments were carried out in triplicate ...
-
No products found
because this supplier's products are not listed.
Yali Zhang, et al.,
bioRxiv - Microbiology 2020
Quote:
... SARS-CoV2-S1 (Sino Biological, 40591-V08H, n=3) and SARS-CoV2-S2 (Sino Biological ...