-
No products found
because this supplier's products are not listed.
Deniz Kent, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 4-Chloro-2-Methylthiopyrimidine (Sigma, 145289), GW3965 (Sigma ...
-
No products found
because this supplier's products are not listed.
Clara R. Stelman, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
No products found
because this supplier's products are not listed.
Katherine M. Oliver, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
No products found
because this supplier's products are not listed.
Jakub Netolicky, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 7-Chloro-4-hydroxy-3-(3-phenoxy)phenyl-2(1H)-quinolinone (L-701-324; Tocris); (R)-3-(2-Carboxypiperazin-4-yl)propyl-1-phosphonic acid ((R)-CPP ...
-
No products found
because this supplier's products are not listed.
Gabriel A. Yette, Scott Stewart, Kryn Stankunas,
bioRxiv - Developmental Biology 2021
Quote:
... and 175 μg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Promega). Reactions were stopped with three PBS rinses ...
-
No products found
because this supplier's products are not listed.
Fumiya Kozawa, et al.,
bioRxiv - Cell Biology 2024
Quote:
... MRS 2211 (2-[(2-chloro-5-nitrophenyl)azo]-5-hydroxy-6- methyl-3-[(phosphonooxy)methyl]-4-pyridinecarboxaldehyde disodium salt and MRS 2395 (2,2-dimethyl-propionic acid 3-(2-chloro-6-methylaminopurin-9- yl)-2-(2,2-dimethyl- propionyloxymethyl)-propyl ester) were obtained from Merck (Darmstadt, Germany).
-
No products found
because this supplier's products are not listed.
Rosemaria Serradimigni, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... N-[4-chloro-3-(trifluoromethyl)phenyl]-2-ethoxy-6-pentadecyl-benzamide (CTPB) (CAS #: 586976-24-1) (>99% purity) was purchased from Abcam (Cambridge, United Kingdom). For both chemicals ...
-
No products found
because this supplier's products are not listed.
Axel Guilbaud, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 5’-Ethynyl-2’-deoxycytidine and 5’-chloro-2’- deoxycytidine were obtained from Cayman Chemical Company (Ann Arbor ...
-
No products found
because this supplier's products are not listed.
Neha Nanajkar, et al.,
bioRxiv - Biophysics 2024
Quote:
... composed of 3:1 1palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC): 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoL-serine (POPS) (Avanti Polar Lipids, Alabaster, AL) were prepared using extrusion and sonication methods ...
-
No products found
because this supplier's products are not listed.
Melanie Werner-Klein, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Alkaline phosphatase was developed with 5-bromo-4-chloro-3-indolyl phosphate and Nitroblue tetrazolium (BCIP/NBT; BioRad, Germany) as substrate ...
-
No products found
because this supplier's products are not listed.
Paul-Lennard Mendez, et al.,
bioRxiv - Genomics 2024
Quote:
... SMAD2/3 (SMAD 2/3 XP, Cell Signaling Technology 8685) or isotype control (Rabbit IgG XP ...
-
No products found
because this supplier's products are not listed.
Yuishin Kosaka, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... The deletion of the lacZ gene was verified using blue-white selection on an LB agar plate containing 0.1 mM isopropyl-β-D-thiogalactopyranoside (Nacalai Tesque) and 4.0 × 10−3 % 5-bromo-4-chloro-3-indolyl-β-D-galactoside (Takara Bio).
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Vakil Takhaveev, et al.,
bioRxiv - Genomics 2024
Quote:
... and 2 µL 10x NEBuffer 3 (NEB) in a total volume of 20 µL and was incubated for 40 min at 37 °C and 60 min at 45 °C ...
-
No products found
because this supplier's products are not listed.
Rutger D. Luteijn, et al.,
bioRxiv - Immunology 2022
Quote:
... 2′3′- cyclic-di-GMP-AMP (2′3′-cGAMP) (Invivogen cat. no. tlrl-nacga23), and human IFN-β (PeproTech ...
-
No products found
because this supplier's products are not listed.
Amandine Jarysta, Basile Tarchini,
bioRxiv - Developmental Biology 2021
Quote:
rabbit anti-GNAI1/2/3 (Santa Cruz; sc-262 ...
-
No products found
because this supplier's products are not listed.
Pata-Eting Kougnassoukou Tchara, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 3 µg of psPAX.2 (Addgene, #12260), and 3 µg of sgRNA plasmid into HEK293T cells seeded in 6-well plates at 70% confluence using jetPRIME transfection reagent according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Patrick O. Byrne, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... IgG(1/2/3)-FITC (BD Pharmingen), and IgM-PE-Cy7 (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
Jin-Woong Heo, et al.,
bioRxiv - Physiology 2023
Quote:
... for 2□min and 3% lead citrate (EMS, 22410) for 1□min ...
-
No products found
because this supplier's products are not listed.
Yu H. Sun, et al.,
bioRxiv - Genomics 2020
Quote:
... This mixture was aliquoted in 2-3 cryovials (Corning, NY), secured on an aluminum cryocane ...
-
No products found
because this supplier's products are not listed.
Yun Deng, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... with 5-bromo-4-chloro-3-indolyl-phosphate nitro blue tetrazolium staining (Vector Laboratories, Burlingame, CA, USA). 10 ∼ 30 embryos were used for each probe ...
-
No products found
because this supplier's products are not listed.
Konstantinos Sofiadis, et al.,
bioRxiv - Genomics 2020
Quote:
... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Yuting Wang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 2-3 months old male young (Jackson Lab #00664) or 2-3 months old GFP+ male young (Jackson Lab #006567 ...
-
No products found
because this supplier's products are not listed.
Sara F. Costa, et al.,
bioRxiv - Microbiology 2023
Quote:
... with 100 μg/mL 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal, VWR), or with 0.1 μM CdCl2 (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Amanda J Eakin, et al.,
bioRxiv - Cell Biology 2020
Quote:
... rat anti-mouse Mac-2 (Galectin-3, 125402, Biolegend) for myeloid cells (Ho and Springer 1982) ...
-
No products found
because this supplier's products are not listed.
Hiroaki Takebe, et al.,
bioRxiv - Microbiology 2024
Quote:
... version 3 (2×300 bp read length; Illumina), following to the manufacturer’s instruction.
-
No products found
because this supplier's products are not listed.
Kamal L Nahas, et al.,
bioRxiv - Cell Biology 2021
Quote:
3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ...
-
No products found
because this supplier's products are not listed.
Marta E. Stremska, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 μm (#19118-2; Polysciences) or 6 μm (#17145-4 ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Ole A.W. Haabeth, et al.,
bioRxiv - Immunology 2021
Quote:
... After washing wells were incubated with a 5-bromo-4-chloro-3⍰-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) substrate (R&D systems, mouse IFNγ Kit Cat # EL485). Plates were scanned and analyzed using ImmunoSpot Microanalyzer.
-
No products found
because this supplier's products are not listed.
Giulio Donati, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 2 ng/mL murine interleukin 3 (PeproTech, Rocky Hill, NJ, USA). Prior to experiments involving IACS-010759 ...
-
No products found
because this supplier's products are not listed.
Masahito Yamagata, Wenjun Yan, Joshua R. Sanes,
bioRxiv - Neuroscience 2020
Quote:
... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
No products found
because this supplier's products are not listed.
Sina Ibne Noor, et al.,
bioRxiv - Biochemistry 2020
Quote:
... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
No products found
because this supplier's products are not listed.
Sangin Kim, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 5-chloro-2ʹ-deoxyuridine (CldU) (#105478) (MP Biomedicals); Shield1 (632189 ...
-
No products found
because this supplier's products are not listed.
Julianna L. Sun, et al.,
bioRxiv - Microbiology 2022
Quote:
... Membranes were developed using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) (Sigma Aldrich, 11697471001. Images were captured using a Nikon Z1000 microscope.
-
No products found
because this supplier's products are not listed.
Ella J. Gehrke, et al.,
bioRxiv - Genetics 2023
Quote:
... OCT was performed at 2- and 3-weeks post-injection (WPI), then 1- ...
-
No products found
because this supplier's products are not listed.
Damien Detraux, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Cells were passaged every 2-3 days using accutase (Stemcell Technologies, #07920). Cells were then collected by centrifugation at 1200 rpm for 3 minutes and counted before seeding ...
-
No products found
because this supplier's products are not listed.
Suphia Rafique,
bioRxiv - Plant Biology 2021
Quote:
... 100 mM DTT and 2% v/v IPG buffer pH 3– 10 (GE Healthcare) was applied to the strips ...
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004185,
Bulk, Inquire
Ask
Hirofumi Fujita, Takashi Kodama, Sascha du Lac,
bioRxiv - Neuroscience 2020
Quote:
... Acute bilateral fastigial nuclei were quickly excised with a sharp knife from 2 or 3 cerebellar slices and were then enzymatically digested with cysteine (2 mM)-supplemented papain (40 U/ml, Worthington, Lakewood, NJ) and chondroitinase-ABC (1 U/ml ...
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
No products found
because this supplier's products are not listed.
Qiao Wen Tan, Emmanuel Tan, Marek Mutwil,
bioRxiv - Plant Biology 2024
Quote:
... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
No products found
because this supplier's products are not listed.
Christos Georgiadis, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3% human serum (Seralab) +20 ng/ml human recombinant IL-2 (Miltenyi Biotec) and activated with TransAct reagent (Miltenyi Biotec) ...
-
No products found
because this supplier's products are not listed.
Vaky Abdelsayed, et al.,
bioRxiv - Biophysics 2022
Quote:
... including 2-color and 3-color STORM was performed on an IX83 Inverted microscope (Olympus) using a 100x 1.3NA objective (Olympus) ...
-
No products found
because this supplier's products are not listed.
Camila de Britto Pará de Aragão, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Data acquisition (filtered at 2–3 kHz and digitized at 15 kHz; Digidata 1440A, Molecular Devices, CA, USA) was performed using the Axopatch 200B amplifier and the Clampex 10.6 software (Molecular Devices) ...
-
No products found
because this supplier's products are not listed.
Wenchao Li, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... SUMO 2/3 (Proteintech, cat. 11251-1-ap, 1:1000 for WB); Ubiquitin (Proteintech ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Richard B Crouse, et al.,
bioRxiv - Neuroscience 2020
Quote:
... blocked for 2-3 hours (0.3% Triton X-100, American Bioanalytical, Canton, MA; 3% normal donkey serum, Jackson ImmunoResearch, West Grove, PA), then incubated overnight with primary antibodies (1:1000 + 1% normal donkey serum) ...
-
No products found
because this supplier's products are not listed.
Adrian W Hodel, et al.,
bioRxiv - Immunology 2024
Quote:
... turbidity was monitored in 2-minute intervals at 600 nm absorption using a Cytation 3 plate reader (BioTek, Agilent Technologies ...
-
No products found
because this supplier's products are not listed.
Anna Ruzhanskaya, et al.,
bioRxiv - Biochemistry 2020
Quote:
... One was through twice daily measurement of 2 or 3 levels of QC specimens obtained from Beckman Coulter Inc ...
-
No products found
because this supplier's products are not listed.
Juwel Chandra Baray, et al.,
bioRxiv - Immunology 2020
Quote:
... The plate was washed for 3 times then incubated with mouse sera and SARS-CoV-2 Spike antibody (Sino Biological, China) for 2 hours at 37 °C ...