-
No products found
because this supplier's products are not listed.
Jung Ho Yu, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 3-mercaptobenzoic acid (3-MBA, Sigma-Aldrich)-capped gold nanoclusters (3-MBA-Au nanoclusters ...
-
No products found
because this supplier's products are not listed.
Brian D. Alford, Gregory Valiant, Onn Brandman,
bioRxiv - Genomics 2020
Quote:
... and 3 mL acid phenol:chloroform (Thermo Fisher). This mixture was heated to 65°C and shaken at 1400 rpm for 10 minutes followed by 5 minutes on ice ...
-
No products found
because this supplier's products are not listed.
Ethan W. Morgan, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Indole-3-propionic acid and indole-3-lactic acid were from Alfa Aesar (Heysham, UK). AIN93G was purchased from Dyets ...
-
No products found
because this supplier's products are not listed.
Shigeo Takashima, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 15-octadecatrienoic acid (C18:3 ω-3, α-linolenic acid; Cayman Chemical, #90210), all cis-6 ...
-
No products found
because this supplier's products are not listed.
Carol Eisenberg, et al.,
bioRxiv - Neuroscience 2021
Quote:
... kynurenic acid (3 mM KyA, Tocris, Ellisville, MO) in the recording aCSF ...
-
No products found
because this supplier's products are not listed.
Anastasia Yunusova, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 3-Indoleacetic acid (IAA, auxin) (Merck, I2886) and 1-Naphthaleneacetic acid (NAA ...
-
No products found
because this supplier's products are not listed.
Susmita Khamrui, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 3-hydroxy-3-methylglutaric acid (HMG) was obtained from TCI or Cayman Chemicals.
-
No products found
because this supplier's products are not listed.
Sandra M. Holmberg, et al.,
bioRxiv - Microbiology 2023
Quote:
... Slides were run in 3% acetic acid (VWR Chemicals) and stained with Alcian blue (Sigma‒Aldrich ...
-
No products found
because this supplier's products are not listed.
Tatyana Veremeyko, et al.,
bioRxiv - Immunology 2024
Quote:
... 3) lysolipids: lysophosphatidic acid sodium salt (LPA, Abcam ab146430), lysophosphatidylcholine (LPC ...
-
No products found
because this supplier's products are not listed.
Carlos J. Garcia, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Authentic standards of 3,7-Dihydroxy-5-cholan-24-oic Acid (chenodeoxycholic acid) and 3-Hydroxy-11-oxo-5-cholan-24-oic Acid (3-oxo-chenodeoxycholic acid) were purchased from Avanti Polar Lipids (Alabaster, AL, USA). The N-(3α,7α,12α-trihydroxy-5β-cholan-24-oyl)-glycine (glycocholic acid) ...
-
No products found
because this supplier's products are not listed.
Jessica Tang, et al.,
bioRxiv - Genomics 2020
Quote:
... and template-switching oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” indicates a ribonucleic acid base and “+” indicates a locked nucleic acid base; Qiagen). cDNA was amplified using KAPA HiFi HotStart ReadyMix kit (Roche #KK2502 ...
-
No products found
because this supplier's products are not listed.
Kevin C. Wilkins, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 500 mM Auxin (Indole-3-acetic acid) in DMSO (Corning #25950CQC) or DMSO alone were added at a 1:1000 dilution to the media ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
Indole-3-acetic acid (auxin) (MP Biomedicals 102037) was added to the medium either 6 (SCC1-AID ...
-
No products found
because this supplier's products are not listed.
Patarasuda Chaisupa, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... Deuterated indole-3-acetic acid (d7-IAA, Cambridge Isotope Laboratories) was used as an internal standard at a concentration of 75 nM in all samples and standards ...
-
No products found
because this supplier's products are not listed.
Xavier Prasanna, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Indole-3-acetic acid sodium (IAA, Santa Cruz, sc-215171, 500 µM); Human fibronectin (Roche Diagnostics ...
-
No products found
because this supplier's products are not listed.
Cristiane Miranda Franca, et al.,
bioRxiv - Bioengineering 2022
Quote:
... acid solubilized Type 1 collagen from rat tail tendon (3 mg/mL, BD Biosciences) was reconstituted in an ice bath to a final concentration of 2.5 mg/mL ...
-
No products found
because this supplier's products are not listed.
Zhihang Yuan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
No products found
because this supplier's products are not listed.
Raphael Aguillon, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... The PCR products were then loaded and migrated by electrophoresis on a 3% Tris-borate-EDTA (TBE) agarose gel supplemented with GelStar Nucleic Acid Gel Stain (Lonza) for approximately one hour ...
-
No products found
because this supplier's products are not listed.
Rasheduzzaman Rashu, et al.,
bioRxiv - Immunology 2023
Quote:
... with 50 μg of the Toll-like receptor (TLR)3 agonist polyinosinic-polycytidylic acid [poly (I:C)] (InvivoGen), 50 μg of the TLR7 agonist imiquimod (InvivoGen) ...
-
No products found
because this supplier's products are not listed.
Seth D. Reighard, et al.,
bioRxiv - Immunology 2020
Quote:
... Following enumeration using 3% acetic acid with methylene blue (StemCell Technologies), splenocytes were resuspended in phosphate-buffered saline and forty to sixty million cells were injected either intraperitoneally or intravenously (via retro-orbital injection under isoflurane anesthesia ...
-
No products found
because this supplier's products are not listed.
Odile Fabre, et al.,
bioRxiv - Cell Biology 2020
Quote:
Fully differentiated C2C12 MS2-CAS myotubes were starved in serum-and glucose-free DMEM for 2 hrs before a 3-hr incubation in low-glucose DMEM/fatty acid-free BSA 0.2% supplemented with radiolabeled glucose (Glucose, D-[3-3H]; 1 μCi/ml; PerkinElmer). Then ...
-
No products found
because this supplier's products are not listed.
Opeyemi Ernest Oludada, et al.,
bioRxiv - Immunology 2023
Quote:
... 1 mM EDTA) and then detected with 2,2’-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) diammonium (ABTS) substrate (Roche Diagnostics) diluted at 1:1000 in H2O2 ...
-
No products found
because this supplier's products are not listed.
Ritu Nayak, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cells were preserved in a 1:3 glacial acetic acid: methanol (Biolabs-chemicals) solution and karyotyped using g-banding.
-
No products found
because this supplier's products are not listed.
Huan Zhang, et al.,
bioRxiv - Microbiology 2022
Quote:
... samples were placed on a microscope slide with 0.8% agarose gel containing 5 μM Bis-(1,3-dibutylbarbituric acid) trimethine oxonol (DiBAC4(3)) (Biotium) and 0.75 μM permeability reporter PI (MP Biomedicals) ...
-
No products found
because this supplier's products are not listed.
Yining Liu, et al.,
bioRxiv - Bioengineering 2023
Quote:
... they were stained in Phosphomolybdic Acid-Phosphotungstic Acid (EMS) for 15 minutes and then in Aniline Blue (EMS ...
-
No products found
because this supplier's products are not listed.
Sibylle Haid, et al.,
bioRxiv - Microbiology 2021
Quote:
... supernatant was harvested from Calu-3 cells and inactivated by addition of lysis buffer (Maxwell 16 viral total nucleic acid purification kit, Promega #AS1150) complemented with proteinase K ...
-
No products found
because this supplier's products are not listed.
Idoia Busnadiego, et al.,
bioRxiv - Immunology 2024
Quote:
... rabbit anti-pSer 14-3-3 Binding Motif (14-3-3 PBM) (#9601, Cell Signaling); rabbit anti-PLEKHG3 (PA5-46053 ...
-
No products found
because this supplier's products are not listed.
Eric T. Hall, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
No products found
because this supplier's products are not listed.
Weiwei Peng, et al.,
bioRxiv - Immunology 2023
Quote:
... in non-reducing conditions and run at 120 V in 3-Morpholinopropane-1-sulfonic acid (MOPS) buffer (Bio-rad). Bands were visualized with Imperial Protein Stain (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Mina N. F. Morcos, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Interleukin-3 (rmIL-3 20ng/ml, PeproTech), Erythropoietin (rhEPO ...
-
No products found
because this supplier's products are not listed.
Hridesh Banerjee, et al.,
bioRxiv - Immunology 2020
Quote:
... Tim-3 clone RMT 3-23 (BioLegend) and clone FAB1529 (R&D) ...
-
No products found
because this supplier's products are not listed.
John R. Ferrarone, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The alleles also contain mutations that confer resistance to CRISPR/Cas9 editing (without changing the amino acid sequence) with all the sgRNAs against LKB1 in the Toronto Knockout version 3 (TKOv3) CRISPR library (Addgene 125517, a gift from Jason Moffat). These alleles were then cloned into pBABE-GFP (Addgene 10668 ...
-
No products found
because this supplier's products are not listed.
Sofie E. Pedersen, et al.,
bioRxiv - Neuroscience 2024
Quote:
... myoinositol (3) and ascorbic acid (0.5) using a vibratome (Leica VT1200, Germany). Brains slices were transferred to an interface type holding chamber filled with 28 °C carbogen saturated ASCF containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Joke De Jaeger-Braet, et al.,
bioRxiv - Cell Biology 2021
Quote:
... the slides were washed in cold 3:1 ethanol:acetic acid and mounted in Vectashield medium with DAPI (Vector Laboratories).
-
No products found
because this supplier's products are not listed.
Stefano Comazzetto, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Mx1-Cre mice were given 3 intraperitoneal injections over 5 days of 40µg of polyinosinic-polycytidilic acid (poly I:C) (GE Healthcare) dissolved in PBS ...
-
No products found
because this supplier's products are not listed.
Muhammad M. Hasan, et al.,
bioRxiv - Microbiology 2021
Quote:
... a synthetic 999 bp fragment of the recodonized version of the CpMetRS (starting from amino acid number 247) along with the 3’UTR sequence of the enolase gene (cgd5_1960) was purchased (GenScript, NJ, USA). The synthetic construct was PCR amplified to introduce desired mutations and the 5’ homology region was introduced as an overhang in the forward primer ...
-
No products found
because this supplier's products are not listed.
Amber L. Altrieth, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 1% Acetic Acid (Polysciences) was pipetted directly onto the sections for one minute ...
-
No products found
because this supplier's products are not listed.
Katherine S Stewart, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 9-cis retinoic acid and all-trans retinoic acid (both R&D Systems) were each dissolved in 100% DMSO ...
-
No products found
because this supplier's products are not listed.
Jia Nong, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... and 0.1% v/v trifluoroacetic acid and running through a C8 column (Eclipse XDB-C8, 3 μm, 3.0×100 mm, Phenomenex) at a flow rate of 0.6 mL/minute ...
-
No products found
because this supplier's products are not listed.
Parham Ramezani-Rad, et al.,
bioRxiv - Immunology 2024
Quote:
... The reaction was stopped with 2N of sulfuric acid (Ricca Chemical Cat# 8310-32) and read at 450 nm on a FlexStation 3 plate reader (Molecular Devices).
-
No products found
because this supplier's products are not listed.
Tomonari Matsuda, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 (Illumina).
-
No products found
because this supplier's products are not listed.
Raianna F. Fantin, et al.,
bioRxiv - Immunology 2024
Quote:
... Plates were developed for 10 minutes at room temperature and then the reaction was stopped by adding 50 μL 3 M hydrochloric acid (HCl, Fisher) and plates were read using a Synergy 4 (BioTek) plate reader at an optical density (OD ...
-
No products found
because this supplier's products are not listed.
Tegan S. Horan, et al.,
bioRxiv - Genetics 2023
Quote:
... the cell pellet was resuspended in PBS supplemented with 2 % FCS and nucleated cells were counted in methylene blue with 3 % acetic acid on a Vi-Cell XR cell viability counter (Beckman Coulter). 10 × 106 bone marrow cells were resuspended in 200 μl of PBS supplemented with 2 % FCS containing the following antibody solution ...
-
No products found
because this supplier's products are not listed.
Lindsey M. Biggs, Elizabeth A.D. Hammock,
bioRxiv - Neuroscience 2022
Quote:
... glass pipettes (3-8 MΩ, 1B150F-3, World Precision Instruments) were pulled using a horizontal puller (Sutter Instruments ...
-
No products found
because this supplier's products are not listed.
Lina Hacker, et al.,
bioRxiv - Bioengineering 2020
Quote:
DNA was isolated from liver samples of female C57BL/6J mice (3-4 months; n=3) and Wistar rats (6-9 months; n=3) (Charles River) using the Qiagen DNeasy Blood/Tissue kit following the manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Vidur Garg, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... + 3% donkey serum (Jackson ImmunoResearch)] at room temperature for 15 mins ...
-
No products found
because this supplier's products are not listed.
Allen K. Kim, Helen D. Wu, Takanari Inoue,
bioRxiv - Cell Biology 2020
Quote:
... filter wheels (Lambda 10-3, Sutter Instruments), and LED light source (pE-300 ...
-
No products found
because this supplier's products are not listed.
Timm O. Koller, et al.,
bioRxiv - Biochemistry 2022
Quote:
Grids (Quantifoil R3/3 Cu300 with 3 nm holey carbon) were glow discharged and 4 µL of sample (8 OD260/mL ...
-
No products found
because this supplier's products are not listed.
Russell Spencer-Smith, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 3-liter Bioflo 110 (Eppendorf) were used ...