-
No products found
because this supplier's products are not listed.
Aashutosh Vihani, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 1% 2-ethyl-3-methylpyrazine (Sigma W315508), 1% 2,5-dimethylpyrazine (Sigma 17542015) ...
-
No products found
because this supplier's products are not listed.
Leonard A. Daly, et al.,
bioRxiv - Biochemistry 2023
Quote:
The panel of synthetic peptide standards and the products of immunoprecipitated heparan-sulfate 6-O-sulfotransferase 1/2/3 (H6ST-1/2/3) in vitro Tyr sulfation assays were analyzed using Proteome Discoverer 2.4 (Thermo Scientific) in conjunction with MASCOT 59 against either a custom database of all (12 ...
-
No products found
because this supplier's products are not listed.
Neha Nanajkar, et al.,
bioRxiv - Biophysics 2024
Quote:
... composed of 3:1 1palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC): 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoL-serine (POPS) (Avanti Polar Lipids, Alabaster, AL) were prepared using extrusion and sonication methods ...
-
No products found
because this supplier's products are not listed.
NR Patel, A Blanks, Y Li, MC Prieto, SM Meadows,
bioRxiv - Molecular Biology 2021
Quote:
... ERG1/2/3 (Abcam, ab196149, 1:200), GM130 (BD ...
-
No products found
because this supplier's products are not listed.
Alexa C. Cannon, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... PAK 1/2/3 1:1000 (Cell Signaling Technology Cat# 2604, RRID:AB_2160225), Myc-Tag 1:1000 (Cell Signaling Technology Cat# 2276 ...
-
No products found
because this supplier's products are not listed.
Rafiquel Sarker, et al.,
bioRxiv - Physiology 2022
Quote:
... BPTU (1-(2-(2-(tert-butyl)phenoxy)pyridin-3-yl)-3-(4-(trifluoromethoxy) phenyl) urea was from Tocris Bioscience.
-
No products found
because this supplier's products are not listed.
Žiga Avsec, et al.,
bioRxiv - Genomics 2020
Quote:
... ɑ-Pbx 1/2/3 (Santa Cruz, sc-888), and ɑ-Zic3 (Abcam ...
-
No products found
because this supplier's products are not listed.
Patrick O. Byrne, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... IgG(1/2/3)-FITC (BD Pharmingen), and IgM-PE-Cy7 (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
Meng Lu, et al.,
bioRxiv - Cell Biology 2020
Quote:
... cells were seeded on 24 mm glass coverslips and transfected with 2 µg plasmid DNA (1:1.3:3 ratio LAMP1:ER:opto-kinesin) and Fugene6 transfection reagent (Promega 1:3) for 20-30 h prior to imaging ...
-
No products found
because this supplier's products are not listed.
Philipp Wahle, et al.,
bioRxiv - Systems Biology 2022
Quote:
... 2 x 3’ Neoclear (Merck), 2 x 3 ‘ 100% ETOH ...
-
No products found
because this supplier's products are not listed.
Gantsetseg Tumurkhuu, et al.,
bioRxiv - Immunology 2024
Quote:
2’-3-cyclic GMP-AMP (cGAMP) (tlrl-nacga23-1, InvivoGen) was added at 10μg/mL with or without 4μM H151 (inh-h151 ...
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
No products found
because this supplier's products are not listed.
Marta E. Stremska, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 μm (#19118-2; Polysciences) or 6 μm (#17145-4 ...
-
No products found
because this supplier's products are not listed.
Joshua Mills, et al.,
bioRxiv - Microbiology 2023
Quote:
... with a final concentration of 2% formaldehyde and 2% NuSieve 3:1 agarose (Lonza). 5 µg RNA was denatured for 10 min at 70 °C with 1 X MOPS buffer (20 mM MOPS ...
-
No products found
because this supplier's products are not listed.
Shaunak Kar, et al.,
bioRxiv - Synthetic Biology 2024
Quote:
... 2 to 3 μg plasmid was digested with 1 μl NotI (NEB) for 1 h at 37 °C and heat inactivated prior to transformation ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Ravikanth Maddipati, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
No products found
because this supplier's products are not listed.
Katarzyna Zyla-Jackson, et al.,
bioRxiv - Immunology 2023
Quote:
... we incubated sequential de-paraffinized sections with anti-2’,3’-cyclic-nucleotide 3’-phosphodiesterase (CNPase) (mouse CNPase: 1:200 dilution; Biolegend, Inc.), anti-CD3 (rabbit ...
-
No products found
because this supplier's products are not listed.
Belen Calles, Borja Pitarch, Víctor de Lorenzo,
bioRxiv - Microbiology 2024
Quote:
... 2 µg/ml of glycerol 3-phosphate dehydrogenase (Roche) and 5 µg of cell free protein extract ...
-
No products found
because this supplier's products are not listed.
Matilde Murga, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 2 and 1 ng/ml murine interleukin 3 (PeproTech, Rocky Hill, NJ, USA), respectively ...
-
No products found
because this supplier's products are not listed.
Dongbum Kim, et al.,
bioRxiv - Microbiology 2023
Quote:
Calu-3 cells or A549 cells (2 × 106 cells/mouse) in 50% Matrigel (Corning, PBS/Matrigel, 1:1 v/v) were subcutaneously inoculated into the right flank of four-week-old female NRGA mice ...
-
No products found
because this supplier's products are not listed.
Wenchao Li, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... SUMO 2/3 (Proteintech, cat. 11251-1-ap, 1:1000 for WB); Ubiquitin (Proteintech ...
-
No products found
because this supplier's products are not listed.
Roza Izgilov, et al.,
bioRxiv - Cell Biology 2023
Quote:
using a fluorescent glucose analog, 2-NBDG (2-Deoxy-2-[(7-nitro-2, 1, 3-benzoxadiazol-4-yl) amino]-D-glucose) (11046, Cayman chemical). Cultured 3T3-L1 cells “starved” in a glucose-free medium at 37°C for 1 hr ...
-
No products found
because this supplier's products are not listed.
Ruilian Li, et al.,
bioRxiv - Microbiology 2021
Quote:
... After that, Samples were infiltrated in graded mixtures (1:3, 1:1, 3:1) of resin (EMS, Resin Mixture ...
-
No products found
because this supplier's products are not listed.
Katerina Stepankova, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and anti-VGLUT1/2 (Synaptic Systems, #1235503, 1:800, 3 days). Goat anti-host antibodies of the respective primary antibodies conjugated with Alexa Fluor 405 ...
-
No products found
because this supplier's products are not listed.
Adam B. Yasunaga, Isaac T.S. Li,
bioRxiv - Biophysics 2021
Quote:
... the coverslips/slides were placed in a 1% aminosilane solution (94 mL methanol, 1 mL 3-(2-aminoethylamino)propyltrimethoxysilane (VWR, CAS# 1760-24-3), 5 mL glacial acetic acid ...
-
No products found
because this supplier's products are not listed.
Chengyuan Wang, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Samples (3 μl) were applied to Quantifoil 2/1 Cu 300 holey-carbon grids (Quantifoil) glow-discharged 60 s using a PELCO glow-discharge system (Ted Pella) ...
-
No products found
because this supplier's products are not listed.
Yuting Wang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 2-3 months old male young (Jackson Lab #00664) or 2-3 months old GFP+ male young (Jackson Lab #006567 ...
-
No products found
because this supplier's products are not listed.
Karthikeyan Thirugnanam, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Smad 2/3 (Novus Biologicals, Cat# AF3797, 1:200 dilution), GAPDH (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Sina Ibne Noor, et al.,
bioRxiv - Biochemistry 2020
Quote:
... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
No products found
because this supplier's products are not listed.
Sarah Hyllekvist Jørgensen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and AKT 1/2/3 (p-S473) Assay Kits (PerkinElmer). Cell lysis and SureFire Assay were performed following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Hiroaki Takebe, et al.,
bioRxiv - Microbiology 2024
Quote:
... version 3 (2×300 bp read length; Illumina), following to the manufacturer’s instruction.
-
No products found
because this supplier's products are not listed.
Aneela Nomura, et al.,
bioRxiv - Immunology 2023
Quote:
... 2 ng/mL of IL-2 and 3 ng/mL of TGFβ (R&D systems, 7666-MB-055)) conditions ...
-
No products found
because this supplier's products are not listed.
Sergio P. Alpuche-Lazcano, et al.,
bioRxiv - Microbiology 2023
Quote:
The pEGFP-C1 plasmids including AFF4 3’UTR sites “1-2-3” were generated using pEGFP-C1 (Clontech). The following complementary oligonucleotides were annealed in respective pairs as above (1.25 µM each in 75 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Takashi Handa, Rie Harukuni, Tomoki Fukai,
bioRxiv - Neuroscience 2020
Quote:
... and filled with 2-3% Neurobiotin (Vector Laboratories) dissolved in 0.5 M potassium chloride (9-19 MΩ) ...
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004183,
5 gm, $900.00
Ask
Ameen A. Salahudeen, et al.,
bioRxiv - Cell Biology 2020
Quote:
Organoid cultures within 2-3 weeks of primary plating were dissociated with 1 U/ml neutral protease (Worthington, Cat LS02100) and 100 KU of DNase I in organoid media ...
-
No products found
because this supplier's products are not listed.
Katrin Linda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Medium was refreshed every 2-3 days and cells were passaged 1-2 times per week using an enzyme-free reagent (ReLeSR, Stem Cell Technologies). For autophagy induction cells were treated with 200 µM Rapamycin (ChemCruz ...
-
No products found
because this supplier's products are not listed.
Leah M. Williams, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Three human codon-optimized As-NF-κB (named 1, 2, and 3) cDNAs were synthesized by GenScript based on sequences from the transcriptome of A ...
-
No products found
because this supplier's products are not listed.
Kasane Yaguchi, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 2–3 hours in secondary antibody 1:500 anti-chicken-IgY Alexa488-conjugated (Jackson ImmunoResearch cat# 703-545-155) in blocking solution ...
-
No products found
because this supplier's products are not listed.
Michael M. Soniat, et al.,
bioRxiv - Biophysics 2022
Quote:
... The TOP3A-RMI1/2 complex was assembled by incubating purified TOP3A and RMI1/2 (1:3 ratio) followed by purification using a Superdex 200 Increase (GE Healthcare) in buffer I.
-
No products found
because this supplier's products are not listed.
Eleonora Grisard, et al.,
bioRxiv - Cell Biology 2021
Quote:
... rabbit anti-human 14-3-3 1/1000 (EPR6380, GeneTex), rabbit anti-human Lamp1 1/1000 (clone EPR4204 ...
-
No products found
because this supplier's products are not listed.
Kelsey Voss, et al.,
bioRxiv - Immunology 2021
Quote:
... T cells were activated with T cell activation/expansion CD2/3/28 beads at a ratio of 1:2 bead to cells (Miltenyi Biotec). Cultures were maintained in HPLM media with 5% dialyzed FBS (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Qiao Wen Tan, Emmanuel Tan, Marek Mutwil,
bioRxiv - Plant Biology 2024
Quote:
... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
No products found
because this supplier's products are not listed.
Ayijiang Yisimayi, et al.,
bioRxiv - Immunology 2023
Quote:
ELISA assays were conducted by pre-coating ELISA plates with RBD (SARS-CoV-2 wild type, SARS-CoV-2 BA.1, SARS-CoV-2 BA.2 RBD, Sino Biological) at concentrations of 0.03 μg ml−1 and 1 μg ml−1 in PBS overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Anna Ruzhanskaya, et al.,
bioRxiv - Biochemistry 2020
Quote:
... One was through twice daily measurement of 2 or 3 levels of QC specimens obtained from Beckman Coulter Inc ...
-
No products found
because this supplier's products are not listed.
Zachary Beine, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The primary antibody (2-3% serum, 0.4% PBST, 1:500 Rockland 600-401-379) was applied and incubated for ninety minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Ida Paciello, et al.,
bioRxiv - Immunology 2024
Quote:
... 3 µg ml-1 of SARS-CoV-2 subunits diluted in carbonate-bicarbonate buffer (E107, Bethyl Laboratories), were coated in 384-well plates (microplate clear ...
-
No products found
because this supplier's products are not listed.
Eve T. Beauchemin, et al.,
bioRxiv - Microbiology 2022
Quote:
... the bacteria were first incubated in 3 wells of a 96-well plate for 1 hour in an Epoch 2 Microplate Spectrophotometer (BioTek), with optical density measured at 600 nm (OD600) ...
-
No products found
because this supplier's products are not listed.
Matthew S.J. Mangan, et al.,
bioRxiv - Immunology 2021
Quote:
... Rac1/2/3 (1:1000, rabbit polyclonal #2465) from CST, actin (mouse or rabbit, both 1:1,000 dilution) from LI-COR Biosciences ...