-
No products found
because this supplier's products are not listed.
Tristan C. Enzingmüller-Bleyl, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... 0.1% w/v Ferrozine (Disodium-4-[3-pyridin-2-yl-6-(4-sulfonatophenyl)-1,2,4-triazin-5-yl]benzosulfonate (Sigma-Aldrich) in dd ...
-
No products found
because this supplier's products are not listed.
Nitin Wadhwani, et al.,
bioRxiv - Cancer Biology 2022
Quote:
SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
No products found
because this supplier's products are not listed.
Su-Jeong Kim, et al.,
bioRxiv - Neuroscience 2024
Quote:
... and 5 μM (RS)-3-(2-Carboxypiperazin-4-yl)-propyl-1-phosphonic acid (CPP, NMDA receptor antagonist, Tocris, 0173) were added to the aCSF and perfused for 3 min after which the synaptic responses of the neurons to photostimulation were measured again ...
-
No products found
because this supplier's products are not listed.
Aniqa Tasnim, et al.,
bioRxiv - Neuroscience 2023
Quote:
... recovery aCSF included (R,S)-3-(2-Carboxypiperazin-4-yl)propyl-1-phosphonic acid (CPP, 5 μM; Abcam, ab120160) and 2,3-dihydroxy-6-nitro-7-sulfamoyl-benzo[f]quinoxaline (NBQX ...
-
No products found
because this supplier's products are not listed.
Jennifer A Rybak, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Treatments were incubated 2 hours before addition of the MTS (3-(4,5-Dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) reagent (Thermo-Fisher Scientific, Waltham, MA) and incubation was continued another 1.5 hours ...
-
No products found
because this supplier's products are not listed.
Basila Moochickal Assainar, et al.,
bioRxiv - Biophysics 2023
Quote:
... 0.5% NBD-PC (1-palmitoyl-2-(6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl)-sn-glycero-3-phosphocholine (Avanti Polar Lipids, Inc.)) ...
-
No products found
because this supplier's products are not listed.
Solveigh C. Koeberle, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 20 μl, 5 mg/ml, Merck) was added to each well ...
-
No products found
because this supplier's products are not listed.
Roza Izgilov, et al.,
bioRxiv - Cell Biology 2023
Quote:
using a fluorescent glucose analog, 2-NBDG (2-Deoxy-2-[(7-nitro-2, 1, 3-benzoxadiazol-4-yl) amino]-D-glucose) (11046, Cayman chemical). Cultured 3T3-L1 cells “starved” in a glucose-free medium at 37°C for 1 hr ...
-
No products found
because this supplier's products are not listed.
Cintia Checa-Rodríguez, et al.,
bioRxiv - Cell Biology 2023
Quote:
MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay (Roche) was performed following manufacturer’s indications ...
-
No products found
because this supplier's products are not listed.
Gina Partipilo, et al.,
bioRxiv - Bioengineering 2024
Quote:
... disodium;4-[3-pyridin-2-yl-6-(4- sulfonatophenyl)-1,2,4-triazin-5-yl]benzenesulfonate hydrate (Ferrozine, VWR) All media components were autoclaved or sterilized using 0.2 μm PES filters.
-
No products found
because this supplier's products are not listed.
Liang Wang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
No products found
because this supplier's products are not listed.
Konstadinos Moissoglu, et al.,
bioRxiv - Cell Biology 2020
Quote:
... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Qian Chen, et al.,
bioRxiv - Genomics 2020
Quote:
... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
No products found
because this supplier's products are not listed.
Anastasia Selyutina, et al.,
bioRxiv - Microbiology 2020
Quote:
... supplemented with 5 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (Corning, Corning, NY, USA), 50 μg/ml penicillin/streptomycin (Corning) ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
João Leandro, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 4-oxo-5-hexenoic acid was obtained from Santa Cruz Biotechnology and succinylphosphonic acid was from MedChem Express ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Florence E. McLean, et al.,
bioRxiv - Microbiology 2024
Quote:
... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) 25 mM (Lonza, 17-737F), gentamicin 25 μg/ml (Lonza ...
-
No products found
because this supplier's products are not listed.
Pippa F. Cosper, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and stained with antibodies to α-tubulin (YL 1/2; 1:1000, Bio-Rad) and centromeres (HCT-0100 ...
-
No products found
because this supplier's products are not listed.
Ashley N. Anderson, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... followed by 3 x 5 minute washes in 2 × SSC (BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Sunniyat Rahman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
No products found
because this supplier's products are not listed.
Stephanie S. Kim, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
Angela Armento, et al.,
bioRxiv - Cell Biology 2024
Quote:
... bFGF 5 ng/ml (day 2-4, AF-100-18B, Peprotech), activinA 100 ng/ml (day 4-14 ...
-
No products found
because this supplier's products are not listed.
Matthew J. Burke, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
No products found
because this supplier's products are not listed.
Sebastian Ströh, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2% and 3% OsO4 (prepared from 2 mL 4% osmium tetroxide solution, Electron Microscopy Sciences, Hatfield, PA)
-
No products found
because this supplier's products are not listed.
Shun Kishimoto, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... The triarylmethyl EPR oxygen tracer OX063 (methyl-tris[8-carboxy-2,2,6,6-tetrakis[2-hydroxyethyl]benzo[1,2-d:4,5-d0]-bis[1,3]dithiol-4-yl]-trisodium salt) was obtained from GE Healthcare.
-
No products found
because this supplier's products are not listed.
Rayan Khaddaj-Mallat, et al.,
bioRxiv - Neuroscience 2021
Quote:
Pericytes viability was assessed using the 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) assay according to the manufacturer’s procedure (Cell Signaling Technology). Cells were plated at the appropriate concentration in 96-well plates under different experimental conditions ...
-
No products found
because this supplier's products are not listed.
Jeremie Subrini, et al.,
bioRxiv - Genetics 2024
Quote:
... Slides were washed for 5 minutes 3 times and mounted in Vectashield plus DAPI (4’,6-diamidino-2-phenylindole) (Vector Laboratories, USA). Stained testis spreads were imaged using an Olympus delta vision or Zeiss Observer microscope using 40X or 63X objectives.
-
No products found
because this supplier's products are not listed.
Alexia Polissidis, et al.,
bioRxiv - Neuroscience 2021
Quote:
For GBA quantification (n=5 for 4 WPI, n=3 for 8 WPI), the surface function of the Imaris software was used to select only GFP-positive cells by appropriately adjusting the number of voxels as well as the intensity of the GFP channel in the threshold tab ...
-
No products found
because this supplier's products are not listed.
GaYoung Park, et al.,
bioRxiv - Bioengineering 2024
Quote:
... hydrogels of varying Young’s modulus: 5 kPa (4% 20 kDa 4-arm PEG-NB, Creative PEGworks; 2 mM RGD, Genscript), 12 kPa (5% 40 kDa 8-arm PEG-NB ...
-
No products found
because this supplier's products are not listed.
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Addgene)[70] in a ratio of 5:3:2 using polyethylenimine (24765-2, Polysciences). Virus supernatant was harvested 30 h after transfection ...
-
No products found
because this supplier's products are not listed.
Han Zhu, et al.,
bioRxiv - Cell Biology 2022
Quote:
Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Melanie B. Abrams, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... 0.075% 5-fluorooritic acid (Zymo Research)) ...
-
No products found
because this supplier's products are not listed.
Jia J. Li, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Slides were rinsed in tap water and dipped 3-5 times in 0.5% Acid Alcohol (Leica Biosystems 3803651), followed by rinsing in tap water and bluing with Scott’s Tap Water (Electron Microscopy Sciences 2607007 ...
-
No products found
because this supplier's products are not listed.
Keisuke Fujiyama, et al.,
bioRxiv - Biochemistry 2021
Quote:
Structural models of polyenoyl tetramic acids 3 and 4 were built and energy minimized using Chem3D v.16.0 (Perkin Elmer). The terminal region of polyenes ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Abdel Rahman Abdel Fattah, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... organoids were treated from days 3 - 5 with ROCKi-free neural differentiation medium supplemented with retinoic acid (RA) (Stemcell Technologies) at 0.25 μM and smoothened agonist (SAG ...
-
No products found
because this supplier's products are not listed.
Antonio Marino, et al.,
bioRxiv - Systems Biology 2023
Quote:
... 4 3 2.0 mm SecurityGuard (Phenomenex) cartridge as a guard column ...
-
No products found
because this supplier's products are not listed.
Steven Tau, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Plates were imaged every 3-4 d on a Cytation 5 (BioTek) with 4x magnification and phase contrast ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
Indole-3-acetic acid (auxin) (MP Biomedicals 102037) was added to the medium either 6 (SCC1-AID ...
-
No products found
because this supplier's products are not listed.
Yoko Hayashi-Takanaka, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and centrifuged at 40,000 rpm (∼128,000 × g) for 3 h at 4°C using an MLS-5 rotor (Beckman Coulter). Aldolase (158 kDa ...
-
No products found
because this supplier's products are not listed.
Piyush Daga, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4% (3-Aminopropyl)triethoxysilane(APTES)-treated and 2% glutaraldehyde-activated glass-bottom dishes (Ibidi) were used to cast polyacrylamide (PAA ...
-
No products found
because this supplier's products are not listed.
Sawsan S Alamri, et al.,
bioRxiv - Immunology 2021
Quote:
... were coated overnight at 4°C with the SARS-CoV-2 S1 subunit (amino acids 1–685) (Sino Biological, China) at 1 μg/ml in PBS (50 ul/well) ...
-
No products found
because this supplier's products are not listed.
Lara Taniguchi, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Borosilicate glass pipettes (3–4 MΩ, Molecular Devices) filled with internal solution (295–305 mOsm ...
-
No products found
because this supplier's products are not listed.
Nioosha Nekooie-Marnany, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Cy-3 or Cy-5 (Jackson Immunoresearch Laboratories), and processed for DAPI or Hoechst staining to visualize cells’ nuclei before mounting in ImmuMount medium (Shandon) ...
-
No products found
because this supplier's products are not listed.
Mario Mietzsch, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 3.5 μL was applied to a glow-discharged Quantifoil copper grid with 2 nm continuous carbon support over holes (Quantifoil R 2/4 400 mesh), blotted ...
-
No products found
because this supplier's products are not listed.
Valentina Salvi, et al.,
bioRxiv - Immunology 2021
Quote:
... and PE-conjugated anti-IL-4 (clone 7A3-3, Miltenyi Biotec) following the manufacturer’s recommendations ...
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... Cortical layers 2/3 and 4 neurons were visualized by using an upright microscope and camera system (BX51WIF, Olympus, and SciCam Pro CCD camera ...
-
No products found
because this supplier's products are not listed.
Michael S. Haney, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Cells were incubated in PBS with 3% donkey serum and the following primary antibodies overnight at 4 °C: rabbit anti-Perilipin 2 (1:200; Proteintech 15294-1-AP), rabbit anti-ACSL1 (1:100 ...