-
No products found
because this supplier's products are not listed.
Megan L. Schaller, et al.,
bioRxiv - Physiology 2024
Quote:
... Samples were incubated in 3% acetic acid for 3 minutes followed by Alcian Blue (Newcomer Supply, 1003A) for 30 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Zhiyi Liu, et al.,
bioRxiv - Immunology 2022
Quote:
... NIH/3T3 SMAD2/3-luciferase reporter cell line (Signosis) was co-cultured with BALF ...
-
No products found
because this supplier's products are not listed.
Nguyen-Vi Mohamed, et al.,
bioRxiv - Neuroscience 2021
Quote:
... hMOs were incubated in a shaker (100 rpm, 37°C) for 3 days with primary antibodies: rabbit anti-tyrosine hydroxylase (TH, 1:500, Pel-Freez Biologicals, AR, USA) and chicken anti-microtubule associated protein 2 (MAP2 ...
-
No products found
because this supplier's products are not listed.
Mathew Miller, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Plates were washed again and incubated for 1h with K2 anti-dsRNA (SCICONS). After another wash ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Pauline Bohne, et al.,
bioRxiv - Neuroscience 2023
Quote:
... connected to the ‘Brain Infusion Kit 3’ (#0004760, Durect). Pumps were prepared sterilely according to the manual ...
-
No products found
because this supplier's products are not listed.
Elena Martínez-Balsalobre, et al.,
bioRxiv - Genetics 2021
Quote:
... A 3-mm-diameter platinum plate electrode (CUY 650-P3 Tweezers, Protech International) localized the pulses to approximately the dorsal one-half of the fin ...
-
No products found
because this supplier's products are not listed.
Navid Farhoudi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 19.1 mg of 3-aminophenylboronic acid (3-APB, Frontier Scientific) was dissolved in 87 µL of dimethyl sulfoxide (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Shivanand Hegde, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 min 3% bleach+0.01% Coverage Plus NPD (Steris Corp.), 5 min in 70% ethanol then rinsed three times in sterile water ...
-
No products found
because this supplier's products are not listed.
Ke-Ming Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
... (3) Air Samples: BioSamplers KIT (225-9595, SKC, Eighty Four, PA) were installed at approximately 1.5 meters above floor at the ventilation points in the slaughter area ...
-
No products found
because this supplier's products are not listed.
Alex M. Jaeger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µM CHIR99021 (AbMole), 1 µM PD0325901(AbMole)] ...
-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... 3% Trichloroacetic acid (Glen Research) as the deblocking solution ...
-
No products found
because this supplier's products are not listed.
Sang-Chul Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... polyclonal anti-CCA1 (R1234-3, Abiocode), and polyclonal anti-histone H3 (A01502 ...
-
No products found
because this supplier's products are not listed.
Laura E. Doepker, et al.,
bioRxiv - Immunology 2019
Quote:
Immunolon 2HB ELISA plates were coated with 1 μg ml−1 ZM109 gp120 monomer or C.ZA.1197MB gp41 ectodomain (Immune Technology Corp.) in 0.1M sodium bicarbonate ...
-
No products found
because this supplier's products are not listed.
Skylar J. Ferrara, et al.,
bioRxiv - Immunology 2021
Quote:
... Quantification of TREM2 concentration via ELISA was performed using a TREM2 ELISA kit (Reddot Biotech Inc). following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Kylie M. Konrath, et al.,
bioRxiv - Immunology 2021
Quote:
... and 6μg pNL4-3.luc.R-E- backbone (Aldevron) and incubated for 48 hours ...
-
No products found
because this supplier's products are not listed.
Stephen Meek, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). Attached EBs were fed every 4 days with Macrophage Induction medium ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... We performed separate 3 (GVS: LGVS vs. RGVS vs. Sham) × 2 (Velocity ...
-
No products found
because this supplier's products are not listed.
Galen J. Correy, et al.,
bioRxiv - Biochemistry 2022
Quote:
... mounted on B3-3 magnetic bases (Mitegen, GB-B3-R). MicroRT tubing (Mitegen ...
-
No products found
because this supplier's products are not listed.
Jason Yun, et al.,
bioRxiv - Bioengineering 2023
Quote:
... indole-3-acetic acid from Neta Scientific (Hainesport, NJ, USA), asunaprevir was purchased from AdooQ Biosciences (Irvine ...
-
No products found
because this supplier's products are not listed.
Eric Waltari, et al.,
bioRxiv - Immunology 2019
Quote:
We printed our arrays with the PDC70 type 3 nozzle (Scienion) due to its reduced dispense volume and the specific hydrophobic coating optimized to improve the dispense stability of protein solutions ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Alyssa Ann La Bella, et al.,
bioRxiv - Microbiology 2022
Quote:
... When urine was supplemented with Fg (Enzyme Research Laboratories FIB 3), it was added directly to the sterilized urine and the urine was not sterilized after the addition of Fg.
-
No products found
because this supplier's products are not listed.
Mizuho Nosaka, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... tPA (Mouse tPA ELISA Kit, PA92, Oxford Biomedical Research, Rochester Hills, MI), uPA (Active mouse uPA Functional Assay Kit ...
-
No products found
because this supplier's products are not listed.
Alberto Domingo López-Muñoz, et al.,
bioRxiv - Microbiology 2021
Quote:
... alone or in combination with purified recombinant proteins were placed in the lower chamber of a 96-well ChemoTx System plate (Neuro Probe # 101-3 and # 101-5) in RPMI 1640 1% FBS ...
-
No products found
because this supplier's products are not listed.
Maia Moog, Scott C. Baraban,
bioRxiv - Neuroscience 2022
Quote:
... were amplified at a gain of 20x and filtered at 1 kHz (−3 dB; eight-pole Bessel; Cygnus Technology, Inc.), digitized at 10 kHz using a Digidata 1320 A/D interface (Molecular Devices ...
-
No products found
because this supplier's products are not listed.
Razieh Rafieenia, et al.,
bioRxiv - Microbiology 2022
Quote:
... Glyphosate concentrations were measured using a glyphosate ELISA kit (Abraxis, Eurofin Technologies, Hungary).
-
No products found
because this supplier's products are not listed.
Steven J. Grzegorski, et al.,
bioRxiv - Genetics 2019
Quote:
... Prothrombin levels in the expression media and the cell lysate were then quantified by ELISA using a matched-pair antibody set ELISA kit (Affinity Biologicals Inc.; FII-EIA).
-
No products found
because this supplier's products are not listed.
Tomasz Zieliński, et al.,
bioRxiv - Biophysics 2022
Quote:
... CytoGlow™ Cofilin (Phospho-Ser3) Colorimetric Cell-Based ELISA Kit was applied (Assay Biotechnology) to monitor target proteins concentration ...
-
No products found
because this supplier's products are not listed.
Yann Ehinger, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Rabbit anti-VGUT1 antibody (VGT1-3) was purchased from Mab Technologies (Stone Mountain, GA). Other common reagents were from Sigma Aldrich (St ...
-
No products found
because this supplier's products are not listed.
Alexander Shapson-Coe, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The resin block was trimmed using a 3 mm UltraTrim diamond knife (Diatome, USA) and ultramicrotome (UC6 ...
-
No products found
because this supplier's products are not listed.
Aritra Nath Kundu, et al.,
bioRxiv - Bioengineering 2023
Quote:
... for 3 hours at room temperature in a peptide synthesis vessel (ChemGlass, Vineland, NJ). The peptide solution was filtered to remove the resin and the peptide was precipitated out using diethyl ether at -80°C ...
-
No products found
because this supplier's products are not listed.
Robert J. Fialkowski, et al.,
bioRxiv - Physiology 2022
Quote:
Oxidative DNA damage was evaluated for 8-OhDG damage using a DNA damage ELISA kit (StressMarq Biosciences Inc.) (Fialkowski et al. ...
-
No products found
because this supplier's products are not listed.
Chao Li, et al.,
bioRxiv - Biophysics 2024
Quote:
... Plasma Surface Technology) at 100 W for 3 min and then moved to a vacuum desiccator (Bel-Art F420220000 ...
-
No products found
because this supplier's products are not listed.
Ariane C. Scheuren, et al.,
bioRxiv - Physiology 2020
Quote:
... Markers for bone formation and resorption were measured in technical duplicates using ELISA kits for N-terminal propeptide of type I procollagen (PINP, AC-33F, Immunodiagnostics) and for C-terminal cross-linked telopeptides of type I collagen (CTX-I ...
-
No products found
because this supplier's products are not listed.
Kira Cozzolino, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Nuclear run-ons were performed for 3 minutes at 37°C on a Groovin’ Tubes thermoshaker (Boekel Scientific, 270500), on a mixture of 10 million human and 100,000 Drosophila melanogaster nuclei per replicate ...
-
No products found
because this supplier's products are not listed.
Shene Chiou, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Tissues were homogenised with 10 pcs of 3 mm Acid-Washed Zirconium Beads (OPS diagnostics Cat# BAWZ 3000-300-23) in a Qiagen TissueLyzer II (30 Hz ...
-
No products found
because this supplier's products are not listed.
Stephen C. Gironda, et al.,
bioRxiv - Neuroscience 2022
Quote:
ISF glucose and ethanol concentrations were measured in each ISF sample from 3-month-old APP/PS1 mice (n=4) using the YSI 2900 analyzer (YSI incorporated) per the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Marion Thauvin, et al.,
bioRxiv - Cell Biology 2021
Quote:
... luciferase activity was measured 1 h later with a 96-well plate luminometer (Tristar, Berthold) as described in the HiBiT assay kit (Promega) ...
-
No products found
because this supplier's products are not listed.
Pragya D. Yadav, et al.,
bioRxiv - Microbiology 2022
Quote:
... The plates were blocked with a Liquid Plate Sealer (CANDOR Bioscience GmbH, Germany)/ Stabilcoat (Surmodics) for two hours at 37°C ...
-
Cat# AK290-2,
USD $495.0/kit
Ask
Nisha R. Dhanushkodi, et al.,
bioRxiv - Immunology 2021
Quote:
... Cells were then washed in RPMI medium and plated in specified cell numbers in ELISPOT membrane plates coated with either HSV-1 gD antigen (Virusys) (1ng/well ...
-
No products found
because this supplier's products are not listed.
Samuel J. Gonzalez, et al.,
bioRxiv - Cell Biology 2022
Quote:
20nm gold particles were coated with Eribulin by using an NHS-activated gold nanoparticle conjugation kit (Cytodiagnostics CGN5K-20-1), following the kit instructions ...
-
No products found
because this supplier's products are not listed.
Mengdi Yang, et al.,
bioRxiv - Bioengineering 2022
Quote:
... qRT-PCR was performed in 96-well plates format using FastSYBR Low Rox (CoWin Biosciences) on Quantstudio 3 Real-Time PCR System (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Ekaterini Maria Lyras, et al.,
bioRxiv - Immunology 2022
Quote:
... Lyve-1 (ReliaTech 103-PA50AG; 1:500), Podoplanin (Biolegend 156202 ...
-
No products found
because this supplier's products are not listed.
Carine Rey, et al.,
bioRxiv - Genomics 2022
Quote:
... belari bub-1 (gene mbelari.g12204) (1/10000 Covalab). Two peptides C-ALNASKEKPEEQLD-coNH2 and C-SPIVEDQDHENSTNG-coNH2 were injected in rabbits and the purified serum obtained at day 74 was used for staining.
-
No products found
because this supplier's products are not listed.
Vedagopuram Sreekanth, et al.,
bioRxiv - Bioengineering 2023
Quote:
... were resuspended in 500 μL of hypertonic lysis buffer per plate (40 mM Tris base, 500 mM NaCl, 2 mM MgCl2, and 100 U/ml salt active nuclease (ArcticZymes), and were incubated at 37°C for 1 h to lyse the cells ...
-
No products found
because this supplier's products are not listed.
Guangyi Luo, et al.,
bioRxiv - Cell Biology 2022
Quote:
... rabbit anti-PFK-1 (1:1000, Zen-bio, China), rabbit anti-GP (1:2000 ...
-
No products found
because this supplier's products are not listed.
Katy R. McCarron, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-LC3 (1:200 WB, 1:200 IF, Nanotools; 5F10), anti-p62 (1:1,000 WB ...
-
No products found
because this supplier's products are not listed.
Jeremy Rich, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... visualized using the polink anti rat kit (GBI Labs) and the peroxidase/diaminobenzidine Rabbit PowerVision kit (ImmunoVision Technologies) ...
-
No products found
because this supplier's products are not listed.
Wenwei Li, et al.,
bioRxiv - Microbiology 2021
Quote:
... and 1 mM dithiothreitol) and 50 μL of 1 mM D-luciferin potassium salt (Prolume). The neutralization half-maximal inhibitory dilution (IC50 ...