-
No products found
because this supplier's products are not listed.
Aashutosh Vihani, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 1% 2-ethyl-3-methylpyrazine (Sigma W315508), 1% 2,5-dimethylpyrazine (Sigma 17542015) ...
-
No products found
because this supplier's products are not listed.
Yu Yang, et al.,
bioRxiv - Plant Biology 2020
Quote:
Ethyl methanesulfonate (EMS)-mutagenized M2 seeds (30 ...
-
No products found
because this supplier's products are not listed.
Philip J. M. Brouwer, et al.,
bioRxiv - Immunology 2020
Quote:
... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific). The activated beads were washed three times with 50 mM MES pH 5.0 and added to SARS-CoV-2 S protein which was diluted in 50 mM MES pH 5.0 ...
-
No products found
because this supplier's products are not listed.
Fadilah Fadilah, et al.,
bioRxiv - Biochemistry 2020
Quote:
... ethyl acetate p.a (Merck), KBr Pro spectrophotometry ...
-
No products found
because this supplier's products are not listed.
Dipsikha Biswas, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 500 µl of ethyl acetate (ethyl acetate; VWR) following which they were centrifuged at 500g at RT for 15 min ...
-
No products found
because this supplier's products are not listed.
Stephen D. Glasgow, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 1-[2-(4-Methoxyphenyl)-2-[3-(4-methoxyphenyl)propoxy]ethyl-1H-imidazole hydrochloride (SKF-96365; 1147, Tocris) in ddH20 ...
-
No products found
because this supplier's products are not listed.
Jason S Hong, et al.,
bioRxiv - Immunology 2021
Quote:
... ethyl ester (TMRE) (Abcam), and Mitotracker Greeen (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Corina M. Stewart, et al.,
bioRxiv - Microbiology 2022
Quote:
... 5-(N-ethyl-N-isopropyl)-Amiloride (EIPA, Cayman Chemical), and Akt Inhibitor VIII (Cayman Chemical ...
-
No products found
because this supplier's products are not listed.
Qinqin Fei, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... 1,2-dipalmitoyl-sn-glycero-3-phospho((ethyl-1’,2’,3’-triazole)triethyleneglycolmannose) (ammonium salt) (PA-PEG3-mannose) were purchased from Avanti Polar Lipids (Alabaster, AL, USA). Linoleic acid (LA) ...
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004183,
5 gm, $900.00
Ask
Kai Guo, et al.,
bioRxiv - Immunology 2022
Quote:
... in DMEM containing 0.0002% L-1-(tosylamido-2-phenyl) ethyl chloromethyl ketone (TPCK)-treated trypsin (Worthington Biochemical) with antibiotics ...
-
No products found
because this supplier's products are not listed.
Sanjana Mahadev-Bhat, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Ethyl pyruvate (EP) purchased from Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Djenet Bousbaine, et al.,
bioRxiv - Immunology 2020
Quote:
... Plates were developed with 3-amino-9-ethyl-carbazole substrate (BD ELISPOT AEC Substrate Set) for 10 minutes and air-dried for at least 18 hours ...
-
No products found
because this supplier's products are not listed.
Stephanie S. Kim, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ...
-
No products found
because this supplier's products are not listed.
Viviane S. De Paula, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 5% (v/v) glycerol and 1 mM Tris(2-carboxy-ethyl) phosphine (TCEP) containing an EDTA-free protease inhibitor tablet (Roche). The cell suspension was sonicated on ice and clarified by centrifugation at 27,000g for 15 min ...
-
No products found
because this supplier's products are not listed.
Cagney Coomer, et al.,
bioRxiv - Neuroscience 2023
Quote:
Larvae were anesthetized with 0.02% ethyl 3-aminobenzoate methanesulfonate salt (Tricane, (E10521, Ethyl 3-aminobenzoate methanesulfonate) and mounted in 1% low melting point agarose (50100, Lonza) in a 60 mm x 15 mm petri dish ...
-
No products found
because this supplier's products are not listed.
Arish N. Shah, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... and 0.003% Tricaine (ethyl-3-aminobenzoate-methanesulfonate) for 60 min at 31 °C in a Thermomixer (Eppendorf, Thermomixer R) set to 100 rpm ...
-
No products found
because this supplier's products are not listed.
Leeann Klassen, et al.,
bioRxiv - Microbiology 2020
Quote:
... and re-dissolved and diluted in ethyl acetate for analysis on an Agilent 7890A-5977B GC-MS system (Agilent Technologies, Inc., CA). Sample solution (1 μL ...
-
No products found
because this supplier's products are not listed.
Senthil-Kumar Devan, et al.,
bioRxiv - Microbiology 2022
Quote:
... 20% (w/v) PEG 10000 (Qiagen PEG I, D5). Before harvesting the crystal ...
-
No products found
because this supplier's products are not listed.
Maria-Luisa del Rio, et al.,
bioRxiv - Immunology 2024
Quote:
... and 2 mg/ml 3-[4,5-dimethylthiazol-2-yl]-5-[3-carboxymethoxyphenyl]2-[4-sulfophenyl]-2H-tetrazolium (PMS, Promega) (1/20 ...
-
No products found
because this supplier's products are not listed.
Paul-Lennard Mendez, et al.,
bioRxiv - Genomics 2024
Quote:
... SMAD2/3 (SMAD 2/3 XP, Cell Signaling Technology 8685) or isotype control (Rabbit IgG XP ...
-
No products found
because this supplier's products are not listed.
Vakil Takhaveev, et al.,
bioRxiv - Genomics 2024
Quote:
... and 2 µL 10x NEBuffer 3 (NEB) in a total volume of 20 µL and was incubated for 40 min at 37 °C and 60 min at 45 °C ...
-
No products found
because this supplier's products are not listed.
Juan Qin, et al.,
bioRxiv - Biochemistry 2021
Quote:
... PKAc was immobilized via standard N-hydroxysuccinimide (NHS) / 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) amine coupling on a CM5 (carboxyl methyl dextran) sensor chip (GE Healthcare). Before covalent immobilization of PKAc ...
-
No products found
because this supplier's products are not listed.
David R. Pearce, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-BCL2 (Clone: BCL-2/100/D5; RTU; Leica Biosystems; #PA0117), anti-BCL6 (Clone:LN22 ...
-
No products found
because this supplier's products are not listed.
Rutger D. Luteijn, et al.,
bioRxiv - Immunology 2022
Quote:
... 2′3′- cyclic-di-GMP-AMP (2′3′-cGAMP) (Invivogen cat. no. tlrl-nacga23), and human IFN-β (PeproTech ...
-
No products found
because this supplier's products are not listed.
Christina M. Zarek, et al.,
bioRxiv - Immunology 2022
Quote:
PECs were harvested by peritoneal lavage with 10 ml of complete D5 ((DMEM (Corning), 5% FBS (Biowest) ...
-
No products found
because this supplier's products are not listed.
Pata-Eting Kougnassoukou Tchara, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 3 µg of psPAX.2 (Addgene, #12260), and 3 µg of sgRNA plasmid into HEK293T cells seeded in 6-well plates at 70% confluence using jetPRIME transfection reagent according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Reimi Tada, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Tadpoles and froglets anesthetized with 0.025% or 0.05% ethyl-3-aminobenzoate were observed under a fluorescence stereomicroscope (Nikon SMZ18) with a 0.5x objective lens using a GFP longpass filter (if in a fluorescent view ...
-
No products found
because this supplier's products are not listed.
Hiroaki Takebe, et al.,
bioRxiv - Microbiology 2024
Quote:
... version 3 (2×300 bp read length; Illumina), following to the manufacturer’s instruction.
-
No products found
because this supplier's products are not listed.
Ravikanth Maddipati, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
No products found
because this supplier's products are not listed.
Amanda J Eakin, et al.,
bioRxiv - Cell Biology 2020
Quote:
... rat anti-mouse Mac-2 (Galectin-3, 125402, Biolegend) for myeloid cells (Ho and Springer 1982) ...
-
No products found
because this supplier's products are not listed.
Yuting Wang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 2-3 months old male young (Jackson Lab #00664) or 2-3 months old GFP+ male young (Jackson Lab #006567 ...
-
No products found
because this supplier's products are not listed.
Kamal L Nahas, et al.,
bioRxiv - Cell Biology 2021
Quote:
3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ...
-
No products found
because this supplier's products are not listed.
Giulio Donati, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 2 ng/mL murine interleukin 3 (PeproTech, Rocky Hill, NJ, USA). Prior to experiments involving IACS-010759 ...
-
No products found
because this supplier's products are not listed.
John-Paul Fuller-Jackson, et al.,
bioRxiv - Neuroscience 2024
Quote:
Cleared spinal cords were transferred to ethyl cinnamate and visualized via light sheet microscopy (Ultramicroscope II, Miltenyi Biotec, Germany), using either a zoomable 2x lens (MVPLAPO ...
-
No products found
because this supplier's products are not listed.
JL Loveland, et al.,
bioRxiv - Physiology 2020
Quote:
... Progesterone was extracted with ethyl ether after overnight equilibration (4°C) of the plasma with 1500 dpm of tritiated progesterone (Perkin Elmer, Rodgau, Ermany). Separation of the organic and aqueous phase was conducted similar to the procedure described for the other hormones ...
-
No products found
because this supplier's products are not listed.
Marta E. Stremska, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 μm (#19118-2; Polysciences) or 6 μm (#17145-4 ...
-
No products found
because this supplier's products are not listed.
Takashi Handa, Rie Harukuni, Tomoki Fukai,
bioRxiv - Neuroscience 2020
Quote:
... and filled with 2-3% Neurobiotin (Vector Laboratories) dissolved in 0.5 M potassium chloride (9-19 MΩ) ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
No products found
because this supplier's products are not listed.
Ella J. Gehrke, et al.,
bioRxiv - Genetics 2023
Quote:
... OCT was performed at 2- and 3-weeks post-injection (WPI), then 1- ...
-
No products found
because this supplier's products are not listed.
Damien Detraux, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Cells were passaged every 2-3 days using accutase (Stemcell Technologies, #07920). Cells were then collected by centrifugation at 1200 rpm for 3 minutes and counted before seeding ...
-
No products found
because this supplier's products are not listed.
Camila de Britto Pará de Aragão, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Data acquisition (filtered at 2–3 kHz and digitized at 15 kHz; Digidata 1440A, Molecular Devices, CA, USA) was performed using the Axopatch 200B amplifier and the Clampex 10.6 software (Molecular Devices) ...
-
No products found
because this supplier's products are not listed.
Wenchao Li, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... SUMO 2/3 (Proteintech, cat. 11251-1-ap, 1:1000 for WB); Ubiquitin (Proteintech ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Richard B Crouse, et al.,
bioRxiv - Neuroscience 2020
Quote:
... blocked for 2-3 hours (0.3% Triton X-100, American Bioanalytical, Canton, MA; 3% normal donkey serum, Jackson ImmunoResearch, West Grove, PA), then incubated overnight with primary antibodies (1:1000 + 1% normal donkey serum) ...
-
No products found
because this supplier's products are not listed.
Camille Danne, et al.,
bioRxiv - Immunology 2022
Quote:
Mice were administered drinking water supplemented with 2-3% (wt/vol) DSS (MP Biomedicals) for 5-7 days (depending on colitis severity of each experiment) ...
-
No products found
because this supplier's products are not listed.
Vaky Abdelsayed, et al.,
bioRxiv - Biophysics 2022
Quote:
... including 2-color and 3-color STORM was performed on an IX83 Inverted microscope (Olympus) using a 100x 1.3NA objective (Olympus) ...
-
No products found
because this supplier's products are not listed.
Anna Ruzhanskaya, et al.,
bioRxiv - Biochemistry 2020
Quote:
... One was through twice daily measurement of 2 or 3 levels of QC specimens obtained from Beckman Coulter Inc ...
-
No products found
because this supplier's products are not listed.
Adrian W Hodel, et al.,
bioRxiv - Immunology 2024
Quote:
... turbidity was monitored in 2-minute intervals at 600 nm absorption using a Cytation 3 plate reader (BioTek, Agilent Technologies ...
-
No products found
because this supplier's products are not listed.
Juwel Chandra Baray, et al.,
bioRxiv - Immunology 2020
Quote:
... The plate was washed for 3 times then incubated with mouse sera and SARS-CoV-2 Spike antibody (Sino Biological, China) for 2 hours at 37 °C ...