-
No products found
because this supplier's products are not listed.
Alexandria N. Miller, et al.,
bioRxiv - Biophysics 2022
Quote:
... and 2 µM 9-Amino-6-Chloro-2-Methoxyacridine (ACMA, Sigma-Aldrich) to establish a K+ gradient ...
-
No products found
because this supplier's products are not listed.
Serena Notartomaso, et al.,
bioRxiv - Neuroscience 2024
Quote:
... VU0360172 [N-cyclobutyl-6-(2-(3-fluorophenyl)ethynyl) pyridine-3-carboxamide] was purchased from Tocris Bioscience (Bristol ...
-
No products found
because this supplier's products are not listed.
Clara R. Stelman, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
No products found
because this supplier's products are not listed.
Omobukola Solebo, et al.,
bioRxiv - Microbiology 2021
Quote:
... ACMA stands for 9-amino-6-chloro-2-methoxyacridine (A1324, ThermoFisher Scientific). For each measurement in the spectrofluorometer (Hitachi F-7000) ...
-
No products found
because this supplier's products are not listed.
Fumiya Kozawa, et al.,
bioRxiv - Cell Biology 2024
Quote:
... MRS 2211 (2-[(2-chloro-5-nitrophenyl)azo]-5-hydroxy-6- methyl-3-[(phosphonooxy)methyl]-4-pyridinecarboxaldehyde disodium salt and MRS 2395 (2,2-dimethyl-propionic acid 3-(2-chloro-6-methylaminopurin-9- yl)-2-(2,2-dimethyl- propionyloxymethyl)-propyl ester) were obtained from Merck (Darmstadt, Germany).
-
No products found
because this supplier's products are not listed.
Michelle Y Meng, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... 3-[(2-methyl-1,3-thiazol-4-yl)ethynyl]pyridine (MTEP) hydrochloride was purchased from Abcam, and RO4 was a gift from Dr Wendy Winchester.
-
No products found
because this supplier's products are not listed.
Gabriel A. Yette, Scott Stewart, Kryn Stankunas,
bioRxiv - Developmental Biology 2021
Quote:
... and 175 μg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Promega). Reactions were stopped with three PBS rinses ...
-
No products found
because this supplier's products are not listed.
Luisa Saecker, Hanns Häberlein, Sebastian Franken,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... 1-[2-chloro-6-[[(3-iodophenyl)methyl]amino]-9H-purin-9-yl]-1-deoxy-N-methyl-β-D-ribofuranuronamide (2-Chloro-IB-MECA; Cayman Chemicals, 163042-96-4), [2-Amino-4-[3-(trifluoromethyl)phenyl]-3-thienyl] phenylmethanone (VCP 171 ...
-
No products found
because this supplier's products are not listed.
Yun Deng, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... with 5-bromo-4-chloro-3-indolyl-phosphate nitro blue tetrazolium staining (Vector Laboratories, Burlingame, CA, USA). 10 ∼ 30 embryos were used for each probe ...
-
No products found
because this supplier's products are not listed.
Bolutife Fakoya, et al.,
bioRxiv - Microbiology 2021
Quote:
... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ...
-
No products found
because this supplier's products are not listed.
Shan Lin, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... IL-3 and IL-6 (PeproTech 300-07 ...
-
No products found
because this supplier's products are not listed.
John B. Moldovan, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... approximately 2-3×105 cells were plated per well in 6-well plates (Corning) and transfected with 0.25 μg of “driver” plasmid (pTMO2F3 ...
-
No products found
because this supplier's products are not listed.
Aleksej Drino, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Biotinylated small RNAs were separated from HPDP-biotin and pyridine-2-thione using spin columns (BioRad) in ultra-pure water.
-
No products found
because this supplier's products are not listed.
Jessica Y Chen, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mice used were 2-3-month-old C57BL/6 (Jackson Laboratories, Bar Harbor, ME, #000664) at the time of injury ...
-
No products found
because this supplier's products are not listed.
Basila Moochickal Assainar, et al.,
bioRxiv - Biophysics 2023
Quote:
... 0.5% NBD-PC (1-palmitoyl-2-(6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl)-sn-glycero-3-phosphocholine (Avanti Polar Lipids, Inc.)) ...
-
No products found
because this supplier's products are not listed.
Pinanong Na-Phatthalung, et al.,
bioRxiv - Immunology 2023
Quote:
... The nuclei were stained with 3 µM DAPI (4’,6-diamidino-2-phenylindole; BioLegend, #422801) for 5 min ...
-
No products found
because this supplier's products are not listed.
Paul-Lennard Mendez, et al.,
bioRxiv - Genomics 2024
Quote:
... SMAD2/3 (SMAD 2/3 XP, Cell Signaling Technology 8685) or isotype control (Rabbit IgG XP ...
-
No products found
because this supplier's products are not listed.
Yuishin Kosaka, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... The deletion of the lacZ gene was verified using blue-white selection on an LB agar plate containing 0.1 mM isopropyl-β-D-thiogalactopyranoside (Nacalai Tesque) and 4.0 × 10−3 % 5-bromo-4-chloro-3-indolyl-β-D-galactoside (Takara Bio).
-
No products found
because this supplier's products are not listed.
Rajagopal Ayana, et al.,
bioRxiv - Neuroscience 2021
Quote:
... We pooled 2-3 fishes (6 weeks old) and extracted whole RNA using the RNAEasy Micro kit (Qiagen), with blood ...
-
No products found
because this supplier's products are not listed.
Antonella Bordin, et al.,
bioRxiv - Cell Biology 2022
Quote:
Human umbilical vein endothelial cells (HUVEC) were cultured between passage 3 and 6 in EGM-2 complete medium (Lonza)3,52–55 ...
-
No products found
because this supplier's products are not listed.
Michael H Jones, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 3 and 6 days and subsequently tested by IL-2 ELISA (R&D Systems) according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Chérine Sifri, et al.,
bioRxiv - Molecular Biology 2023
Quote:
U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
No products found
because this supplier's products are not listed.
Estefanía Lozano-Andrés, et al.,
bioRxiv - Biophysics 2022
Quote:
... #131-8; #130-6; #130-5; #130-3 and 2 μm lot MM2307#156; #159.1; #159.2; #122.3, BD Biosciences, San Jose, CA). For calibration of the fluorescence axis in the PE channel ...
-
No products found
because this supplier's products are not listed.
Beth E. Grace, et al.,
bioRxiv - Immunology 2022
Quote:
... 80% confluent HEK293-T cells were transfected with 2 μg of TCR plasmid and 1 μg pCL-Eco helper plasmid with 6 μg (3× DNA mass) PEI (Santa Cruz Biotech) to create retrovirus ...
-
No products found
because this supplier's products are not listed.
Andre Zylstra, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... for 3-6 hours in 20 μl 1x CutSmart buffer (NEB), 0.2 μl was quantified using PicoGreen DNA (Life Technologies) ...
-
No products found
because this supplier's products are not listed.
Rutger D. Luteijn, et al.,
bioRxiv - Immunology 2022
Quote:
... 2′3′- cyclic-di-GMP-AMP (2′3′-cGAMP) (Invivogen cat. no. tlrl-nacga23), and human IFN-β (PeproTech ...
-
No products found
because this supplier's products are not listed.
Sara F. Costa, et al.,
bioRxiv - Microbiology 2023
Quote:
... with 100 μg/mL 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal, VWR), or with 0.1 μM CdCl2 (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Ragunathan Bava Ganesh, Sebastian J. Maerkl,
bioRxiv - Synthetic Biology 2024
Quote:
... Purification column was prepared using 2-3 mL IMAC Sepharose 6 Fast Flow beads (GE Healthcare) and charged with 0.1 N Nickel sulphate solution ...
-
No products found
because this supplier's products are not listed.
Roza Izgilov, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 6-diamidino-2-phenylindole (DAPI) (Electron Microscopy Sciences, #17985-10) and viewed by confocal microscope (Leica SP8 ...
-
No products found
because this supplier's products are not listed.
Sofia E. Luna, et al.,
bioRxiv - Genetics 2024
Quote:
2-3 days post-electroporation HSPCs were plated in SmartDish 6-well plates (cat.: 27370; STEMCELL Technologies, Vancouver, Canada) containing MethoCult H4434 Classic or MethoCult H4434 Classic without EPO (cat. ...
-
No products found
because this supplier's products are not listed.
Gianna Pavilion, et al.,
bioRxiv - Genomics 2024
Quote:
... Citrate pH 6 (Dako, S236984-2) at 100°C for CD206 and CD86 ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Hiroaki Takebe, et al.,
bioRxiv - Microbiology 2024
Quote:
... version 3 (2×300 bp read length; Illumina), following to the manufacturer’s instruction.
-
No products found
because this supplier's products are not listed.
Masahito Yamagata, Wenjun Yan, Joshua R. Sanes,
bioRxiv - Neuroscience 2020
Quote:
... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
No products found
because this supplier's products are not listed.
Marta E. Stremska, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 μm (#19118-2; Polysciences) or 6 μm (#17145-4 ...
-
No products found
because this supplier's products are not listed.
James A. D’Amour, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Electrodes of 4-6 MOhm resistance (borosilicate glass, World Precision Instruments, no. TW150F-3) were prepared on Narishige (PP-830 ...
-
No products found
because this supplier's products are not listed.
Sangin Kim, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 5-chloro-2ʹ-deoxyuridine (CldU) (#105478) (MP Biomedicals); Shield1 (632189 ...
-
No products found
because this supplier's products are not listed.
Malvina Pizzuto, et al.,
bioRxiv - Immunology 2024
Quote:
... or 6-well plates (2 mL/well) (Greiner Bio-One).
-
No products found
because this supplier's products are not listed.
Kamal L Nahas, et al.,
bioRxiv - Cell Biology 2021
Quote:
3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ...
-
No products found
because this supplier's products are not listed.
Qiao Wen Tan, Emmanuel Tan, Marek Mutwil,
bioRxiv - Plant Biology 2024
Quote:
... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
No products found
because this supplier's products are not listed.
Benjamin Furtwängler, et al.,
bioRxiv - Biochemistry 2021
Quote:
... supplemented with growth factors (Miltenyi Biotec, IL-3, IL-6 and G-CSF (10 ng/mL), h-SCF and FLt3-L (50 ng/mL) ...
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
No products found
because this supplier's products are not listed.
Bram Meijlink, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Ultrasound was applied under an incidence angle of 45° in relation to the CLINIcell using a single element focused transducer (2.25 MHz center frequency, 76.2 mm focal length, -6 dB beam width at 2 MHz of 3 mm, V305, Panametrics-NDT, Olympus). The ultrasound pressure output was calibrated using a 1-mm diameter needle hydrophone (PA2293 ...
-
No products found
because this supplier's products are not listed.
Catherine Horiot, et al.,
bioRxiv - Immunology 2023
Quote:
... recombinant human IL-6 (2 ng/mL) (Proteintech) was added to RPMI1640 culture medium containing Ultraglutamine (Lonza ...
-
No products found
because this supplier's products are not listed.
Vikas D. Trivedi, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... OD600 measurement was checked at frequent time intervals (3-6 h) on SpectraMax M3 spectrophotometer (Molecular Devices). Growth rate was determined by plotting the values in GraphPad Prism following non-linear regression and using exponential growth equation ...
-
No products found
because this supplier's products are not listed.
Nittay Meroz, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... The optical density was then measured using 6 automated plate readers (3 Epoch2 microplate reader - BioTek and 3 Synergy microplate reader - BioTek) simultaneously ...
-
No products found
because this supplier's products are not listed.
Juhi Singh, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 6 mM 2-mercaptoethanol and centrifuged with a 70Ti (Beckman coulter) rotor at 40,000 rpm for 18 hours at 4°C ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Richard B Crouse, et al.,
bioRxiv - Neuroscience 2020
Quote:
... blocked for 2-3 hours (0.3% Triton X-100, American Bioanalytical, Canton, MA; 3% normal donkey serum, Jackson ImmunoResearch, West Grove, PA), then incubated overnight with primary antibodies (1:1000 + 1% normal donkey serum) ...
-
No products found
because this supplier's products are not listed.
Emily L. Meany, et al.,
bioRxiv - Bioengineering 2024
Quote:
... to 6 μM biotinylated wildtype SARS-CoV-2 spike trimer (Sino Biological, 40589-V27B-B) in five steps ...