-
No products found
because this supplier's products are not listed.
Jack Whitewolf, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 5-norbornene-2-carboxylic acid (Sigma) was then added to the solution ...
-
No products found
because this supplier's products are not listed.
Matilda Shackley, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 2-(4-chlorophenyl)-3-methyl-N-(thiazole-2-yl)butanamide (4-CMTB; Tocris) was used as a FFAR2-specific agonist and AR420626 (Cayman ...
-
No products found
because this supplier's products are not listed.
Logan D. Morton, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 5-norbornene-2-carboxylic acid (99%, Fisher Scientific) (12:1 to HA-TBA repeat unit) ...
-
No products found
because this supplier's products are not listed.
Romain D. Cazé, et al.,
bioRxiv - Neuroscience 2023
Quote:
D-AP5 (D-(−)-2-Amino-5-phosphonopentanoic acid) and SR 95531 (2-(3-Carboxypropyl)-3-amino-6-(4 methoxyphenyl) pyridazinium bromide) were purchased from Abcam, UK ...
-
No products found
because this supplier's products are not listed.
Sirle Saul, et al.,
bioRxiv - Microbiology 2021
Quote:
... 1% nonessential amino acids (Corning) and 1% penicillin-streptomycin (Gibco) ...
-
No products found
because this supplier's products are not listed.
Jia C. Wang, et al.,
bioRxiv - Immunology 2022
Quote:
... 1,2-dioleoyl-sn-glycero-3-[(N-(5-amino-1-carboxypentyl)iminodiacetic acid)succinyl] (DGS)–NTA and 1,2-dioleoyl-sn-glycero-3-phosphocholine (Avanti Polar Lipids, Inc.) were mixed at 1:3:96 molar % ratio ...
-
No products found
because this supplier's products are not listed.
C.W.E. Embregts, et al.,
bioRxiv - Immunology 2021
Quote:
... 1% nonessential amino acids (Lonza), 1 mM sodium pyruvate (Gibco ...
-
No products found
because this supplier's products are not listed.
Samuel Shields, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 100 µM Trolox ([±]-6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid; Merck), 100 µM nocodazole and 1 nM NAP (a gift from Illana Gozes ...
-
No products found
because this supplier's products are not listed.
Nitin Wadhwani, et al.,
bioRxiv - Cancer Biology 2022
Quote:
SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
No products found
because this supplier's products are not listed.
Charlotte M. M. Gommers, et al.,
bioRxiv - Plant Biology 2020
Quote:
1-Aminocyclopropane-1-carboxylic acid (ACC; VWR P10007) was dissolved in sterile water (10 mM stock ...
-
No products found
because this supplier's products are not listed.
Anika J. Friedman, et al.,
bioRxiv - Biochemistry 2022
Quote:
... and 2-[(Carboxy-carbonyl)amino]-4,5,6,7-tetrahydrothieno[2,3-c]pyridine-3-carboxylic acid hydrochloride (TCS 401) from Cayman Chemical (Ann Arbor, Michigan) and Ertiprotafib from Med-Koo Biosciences ...
-
No products found
because this supplier's products are not listed.
Bradley M. Readnour, et al.,
bioRxiv - Microbiology 2021
Quote:
... succinimidyl ester)-LPSXG-(5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid) (Edans) peptides were provided by GenScript (Piscataway, NJ). Six peptide sequences were selected for study ...
-
No products found
because this supplier's products are not listed.
Xiyu Dong, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 2 mM amino acids (Roche), 1 nM pY71sfGFP plasmid encoding superfolder GFP (M ...
-
No products found
because this supplier's products are not listed.
Konstadinos Moissoglu, et al.,
bioRxiv - Cell Biology 2020
Quote:
... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Vaishali Aggarwal, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... P4HA2 was inhibited by using 20 μmol/L 1,4-dihydrophenonthrolin-4-one-3-carboxylic acid (1,4-DPCA) (SC-200758, Santa Cruz, USA). 1,4-DPCA ...
-
No products found
because this supplier's products are not listed.
Liang Wang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
No products found
because this supplier's products are not listed.
Wataru Tsuchiya, et al.,
bioRxiv - Microbiology 2022
Quote:
... (yeast nitrogen base without amino acids containing 0.17% ammonium sulfate [BD Difco], 2% glucose, 0.13% casamino acids [BD Difco]) was used for yeast culture for mannoprotein preparation.
-
No products found
because this supplier's products are not listed.
Michèle Brocard, et al.,
bioRxiv - Microbiology 2021
Quote:
... Amino acids were separated using a VF-5ms inert 5% phenyl-methyl column (Agilent Technologies). The oven temperature was constant at 120 °C for 5 min ...
-
No products found
because this supplier's products are not listed.
Peng Liu, Ian P. Lapcinski, Karen H. Ashe,
bioRxiv - Biochemistry 2024
Quote:
... that recognizes amino acids 3-8 of Aβ and the Protein G Sepharose 4 Fast Flow resin (GE healthcare) (Tables 2 and 3 ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Magdalena A. Sutcliffe, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... and the NEBNext Multiplex Oligos from Illumina (Index Primers Set 1, 2, 3 and 4, NEB, E7335S, E7500S, E7710S, E7730S), following the manufacturer’s protocols ...
-
No products found
because this supplier's products are not listed.
Stephanie S. Kim, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ...
-
No products found
because this supplier's products are not listed.
Yuhong Wang,
bioRxiv - Biophysics 2023
Quote:
... Radioactive amino acids are purchased from PerkinElmer. Other reagents are from Millipore Sigma if not specified ...
-
No products found
because this supplier's products are not listed.
Sotaro Fujisawa, et al.,
bioRxiv - Immunology 2024
Quote:
... 100 μM nonessential amino acids) containing 100 U/ml recombinant human IL-2 (Peprotech). P14 cells were then transduced with retroviral supernatant containing polybrene (8 μg/ml ...
-
No products found
because this supplier's products are not listed.
Shohei Yamamoto, et al.,
bioRxiv - Cell Biology 2022
Quote:
... the polystyrene beads containing surface primary amino groups (PolySciences, 17145-5, Diameter 3 μm) were incubated with 10 mM of Sulfo-NHS-LC-LC-Biotin (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Rachid Essalmani, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 1% nonessential amino acids (NEAA) and 50 µg/ml blasticidin (Invivogen). The cells were transfected with JetPrime transfection reagent according to the manufacturer’s instructions (Polyplus transfection ...
-
No products found
because this supplier's products are not listed.
Mark van der Kroeg, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 1% minimum essential medium/non-essential amino acid (Stem Cell Technologies), 1% penicillin/streptomycin (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Yuki Kondo, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 3-amino-9-ethylcarbazole (Vector Laboratories, Inc.) was used as a substrate for visualization ...
-
No products found
because this supplier's products are not listed.
M. Eugenia Dieterle, et al.,
bioRxiv - Microbiology 2020
Quote:
... coated with PBS alone or with 2 µg/ml of SARS-CoV-2 S protein in PBS overnight at 4°C were blocked for 1 hour with 3% nonfat dry milk (Biorad) in PBS ...
-
No products found
because this supplier's products are not listed.
Alexa C. Cannon, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... PAK 1/2/3 1:1000 (Cell Signaling Technology Cat# 2604, RRID:AB_2160225), Myc-Tag 1:1000 (Cell Signaling Technology Cat# 2276 ...
-
No products found
because this supplier's products are not listed.
Sawsan S Alamri, et al.,
bioRxiv - Immunology 2021
Quote:
... were coated overnight at 4°C with the SARS-CoV-2 S1 subunit (amino acids 1–685) (Sino Biological, China) at 1 μg/ml in PBS (50 ul/well) ...
-
No products found
because this supplier's products are not listed.
Bianca Castro Gouveia-Mageste, et al.,
bioRxiv - Plant Biology 2020
Quote:
... amino acids 98-106 (Miltenyi Biotec, 130-091-972; 1:10.000) or anti-GFP (Miltenyi Biotec ...
-
No products found
because this supplier's products are not listed.
Sebastian Ströh, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2% and 3% OsO4 (prepared from 2 mL 4% osmium tetroxide solution, Electron Microscopy Sciences, Hatfield, PA)
-
No products found
because this supplier's products are not listed.
Sunniyat Rahman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
No products found
because this supplier's products are not listed.
Icaro Putinhon Caruso, et al.,
bioRxiv - Biophysics 2021
Quote:
... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
No products found
because this supplier's products are not listed.
Ana C. Sias, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and female (GRABDA2h, N =1; GRABDA2m, N = 3) Long Evans rats (Th-cre-littermates, N = 5; Gad-cre-, N = 2; Charles River Laboratories, N = 3) aged 7-9 weeks at the time of surgery were used to record dopamine release in the BLA across Pavlovian trace conditioning ...
-
No products found
because this supplier's products are not listed.
Steven Tau, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Plates were imaged every 3-4 d on a Cytation 5 (BioTek) with 4x magnification and phase contrast ...
-
No products found
because this supplier's products are not listed.
Coralie Hérent, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Cy-3 or Cy-5 (1:500, Jackson ImmunoResearch). Sections were counterstained with a fluorescent Nissl stain (NeuroTrace 435/445 blue ...
-
No products found
because this supplier's products are not listed.
Michael S. Haney, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Cells were incubated in PBS with 3% donkey serum and the following primary antibodies overnight at 4 °C: rabbit anti-Perilipin 2 (1:200; Proteintech 15294-1-AP), rabbit anti-ACSL1 (1:100 ...
-
No products found
because this supplier's products are not listed.
Melanie B. Abrams, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... 0.075% 5-fluorooritic acid (Zymo Research)) ...
-
No products found
because this supplier's products are not listed.
Jia J. Li, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Slides were rinsed in tap water and dipped 3-5 times in 0.5% Acid Alcohol (Leica Biosystems 3803651), followed by rinsing in tap water and bluing with Scott’s Tap Water (Electron Microscopy Sciences 2607007 ...
-
No products found
because this supplier's products are not listed.
Sladjana Skopelja-Gardner, et al.,
bioRxiv - Immunology 2020
Quote:
... Initial experiments were conducted using both male and female C57BL/6J mice (Jackson Labs, 3-4 months old, Figs. 1-2). Female mice were used for all subsequent experiments ...
-
No products found
because this supplier's products are not listed.
Derek Schaeuble, et al.,
bioRxiv - Neuroscience 2023
Quote:
... tissue was blocked again (4% BSA, 3% donkey serum, 0.1% Triton) for 1 hour before incubation in synaptobrevin-2 primary antibody (Synaptic Systems; 104 211C3) (1:200 in blocking solution ...
-
No products found
because this supplier's products are not listed.
Karthikeyan Thirugnanam, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Smad 2/3 (Novus Biologicals, Cat# AF3797, 1:200 dilution), GAPDH (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Yoko Hayashi-Takanaka, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and centrifuged at 40,000 rpm (∼128,000 × g) for 3 h at 4°C using an MLS-5 rotor (Beckman Coulter). Aldolase (158 kDa ...
-
No products found
because this supplier's products are not listed.
David S Uygun, et al.,
bioRxiv - Neuroscience 2021
Quote:
... sIPSCs were recorded at −70 mV in the presence of the glutamate receptor antagonists (20 μM 6-cyano-7-nitroquinoxaline-2,3-dione +50 μM D-(2R)-amino-5-phosphonopentanoic acid) using a Multiclamp 700B amplifier and pClamp 10.0 software (Molecular devices; California, United States). A 1 min period after 5 min application of the glutamate receptor antagonists was used for statistical analysis (Igor software ...
-
No products found
because this supplier's products are not listed.
Annelot C. M. van Esbroeck, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... After rinsing the membrane with TBS-T (3 × 5 min) and TBS (3 × 5 min) fluorescence was detected by scanning on the Odyssey CLx (LI-COR Biosciences).
-
No products found
because this supplier's products are not listed.
Jennifer V. Gerbracht, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The following antibodies were used: anti-CASC3 amino acid residues 653-703 (Bethyl Laboratories, #A302-472A-M), anti-CASC3 amino acid residues 367-470 (Atlas Antibodies ...
-
No products found
because this supplier's products are not listed.
He-Chin Hsieh, et al.,
bioRxiv - Microbiology 2023
Quote:
... and BA.4/5 (Genetex, Cat. No. GTX137098-pro) were mixed with RBD-LTA ...