-
No products found
because this supplier's products are not listed.
Kevin G. Hicks, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 2-amino-3-phosphonopropionic acid (AP-3, Sigma-Aldrich A4910), ATP (Sigma-Aldrich A2383) ...
-
No products found
because this supplier's products are not listed.
Uday Saxena, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
No products found
because this supplier's products are not listed.
Luisa Saecker, Hanns Häberlein, Sebastian Franken,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... [2-Amino-4-[3-(trifluoromethyl)phenyl]-3-thienyl] phenylmethanone (VCP 171; Tocris, 1018830-99-3), 5-[2-(5-nitro-2-furanyl)ethenyl]-2-furancarboxylic acid ...
-
No products found
because this supplier's products are not listed.
Helen Carrasco Hope, et al.,
bioRxiv - Immunology 2020
Quote:
... T cells were cultured with 2-deoxy-2-((7-nitro-2, 1, 3-benzooxadiazol-4-yl)amino)-glucose (2-NBDG) (Abcam 50μM, 1h), 4 ...
-
No products found
because this supplier's products are not listed.
Basila Moochickal Assainar, et al.,
bioRxiv - Biophysics 2023
Quote:
... 0.5% NBD-PC (1-palmitoyl-2-(6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl)-sn-glycero-3-phosphocholine (Avanti Polar Lipids, Inc.)) ...
-
No products found
because this supplier's products are not listed.
Roza Izgilov, et al.,
bioRxiv - Cell Biology 2023
Quote:
using a fluorescent glucose analog, 2-NBDG (2-Deoxy-2-[(7-nitro-2, 1, 3-benzoxadiazol-4-yl) amino]-D-glucose) (11046, Cayman chemical). Cultured 3T3-L1 cells “starved” in a glucose-free medium at 37°C for 1 hr ...
-
No products found
because this supplier's products are not listed.
Cécile Jacques, et al.,
bioRxiv - Cell Biology 2023
Quote:
... plates were treated with 3-amino-propyltrimethoxysilane (diluted 1:2 with PBS; Sigma-Aldrich/Merck) for 15min at RT ...
-
No products found
because this supplier's products are not listed.
Annette B. Vogel, et al.,
bioRxiv - Immunology 2020
Quote:
... streptavidin-HRP and 3-amino-9-ethylcarbazole (AEC) substrate (BD Bioscience) were added and spots counted using a CTL ImmunoSpot S6 Universal Analyzer (CTL) ...
-
No products found
because this supplier's products are not listed.
Claudia Blaurock, et al.,
bioRxiv - Microbiology 2021
Quote:
... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...
-
No products found
because this supplier's products are not listed.
Aaron S. Mendez, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 2mM Mg(OAc)2 and 10μM of the amino acid mixture (Promega). Reactions were incubated with 5μM of the indicated nsp1 protein for 30 min on ice ...
-
No products found
because this supplier's products are not listed.
Yuki Kondo, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 3-amino-9-ethylcarbazole (Vector Laboratories, Inc.) was used as a substrate for visualization ...
-
No products found
because this supplier's products are not listed.
Pierre-Louis Hollier, et al.,
bioRxiv - Neuroscience 2020
Quote:
... non-essential amino acids 2 % (Lonza, Bäle, Switzerland), FGF 1 ng/mL (PeproTech ...
-
No products found
because this supplier's products are not listed.
Paul-Lennard Mendez, et al.,
bioRxiv - Genomics 2024
Quote:
... SMAD2/3 (SMAD 2/3 XP, Cell Signaling Technology 8685) or isotype control (Rabbit IgG XP ...
-
No products found
because this supplier's products are not listed.
Lucas H. Armitage, et al.,
bioRxiv - Immunology 2021
Quote:
... nonessential amino acids (Corning), Glutamax ...
-
No products found
because this supplier's products are not listed.
Martin P. Steinbuck, et al.,
bioRxiv - Immunology 2024
Quote:
... custom 15mer OLPs with 11 amino acid overlap were generated spanning the SARS-CoV-2 Spike RBD WH-01 protein (amino acids R319-S591, GenScript). WH-01 peptides that contained VOC mutation loci were substituted with the corresponding mutant sequences when applicable ...
-
No products found
because this supplier's products are not listed.
Rutger D. Luteijn, et al.,
bioRxiv - Immunology 2022
Quote:
... 2′3′- cyclic-di-GMP-AMP (2′3′-cGAMP) (Invivogen cat. no. tlrl-nacga23), and human IFN-β (PeproTech ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Vakil Takhaveev, et al.,
bioRxiv - Genomics 2024
Quote:
... and 2 µL 10x NEBuffer 3 (NEB) in a total volume of 20 µL and was incubated for 40 min at 37 °C and 60 min at 45 °C ...
-
No products found
because this supplier's products are not listed.
Mi Hyun Seo, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and visualized using a 3-amino-9-ethylcarbazole solution (Santa Cruz Biotechnology, USA) with no counter staining ...
-
No products found
because this supplier's products are not listed.
Elena Izquierdo, et al.,
bioRxiv - Cell Biology 2020
Quote:
Polybead Amino Microsphere 3 μm latex beads (Polysciences INC) were labeled with the fluorescent dye DyLight680 mono-N-hydroxysuccinimide (NHS ...
-
No products found
because this supplier's products are not listed.
Ludovic Enkler, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2% (w/v) glucose and mixtures of amino acids (MP Biomedicals) depending on the auxotrophies used for selection ...
-
No products found
because this supplier's products are not listed.
Pata-Eting Kougnassoukou Tchara, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 3 µg of psPAX.2 (Addgene, #12260), and 3 µg of sgRNA plasmid into HEK293T cells seeded in 6-well plates at 70% confluence using jetPRIME transfection reagent according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Xiyu Dong, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 2 mM amino acids (Roche), 1 nM pY71sfGFP plasmid encoding superfolder GFP (M ...
-
No products found
because this supplier's products are not listed.
Giorgia Cimato, et al.,
bioRxiv - Microbiology 2024
Quote:
... Staining was done with 3-amino-9-ethylcarbazole (AEC) (BioLegend, Amsterdam, The Netherlands) as HRP substrate ...
-
No products found
because this supplier's products are not listed.
Stephanie S. Kim, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ...
-
No products found
because this supplier's products are not listed.
Jooyoung Kim, et al.,
bioRxiv - Neuroscience 2023
Quote:
... for 2 min and 3% lead citrate (EMS, #22410) for 1 min ...
-
No products found
because this supplier's products are not listed.
Ravikanth Maddipati, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
No products found
because this supplier's products are not listed.
Yuting Wang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 2-3 months old male young (Jackson Lab #00664) or 2-3 months old GFP+ male young (Jackson Lab #006567 ...
-
No products found
because this supplier's products are not listed.
Androniqi Qifti, et al.,
bioRxiv - Physiology 2021
Quote:
... 1% non-essential amino acids (VWR) and 1% L-glutamine (VWR) ...
-
No products found
because this supplier's products are not listed.
Sotaro Fujisawa, et al.,
bioRxiv - Immunology 2024
Quote:
... 100 μM nonessential amino acids) containing 100 U/ml recombinant human IL-2 (Peprotech). P14 cells were then transduced with retroviral supernatant containing polybrene (8 μg/ml ...
-
No products found
because this supplier's products are not listed.
Peng Liu, Ian P. Lapcinski, Karen H. Ashe,
bioRxiv - Biochemistry 2024
Quote:
... that recognizes amino acids 3-8 of Aβ and the Protein G Sepharose 4 Fast Flow resin (GE healthcare) (Tables 2 and 3 ...
-
No products found
because this supplier's products are not listed.
Kamal L Nahas, et al.,
bioRxiv - Cell Biology 2021
Quote:
3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Eric T. Hall, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
No products found
because this supplier's products are not listed.
Hiroaki Takebe, et al.,
bioRxiv - Microbiology 2024
Quote:
... version 3 (2×300 bp read length; Illumina), following to the manufacturer’s instruction.
-
No products found
because this supplier's products are not listed.
Sarah Hyllekvist Jørgensen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and AKT 1/2/3 (p-S473) Assay Kits (PerkinElmer). Cell lysis and SureFire Assay were performed following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Damien Detraux, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Cells were passaged every 2-3 days using accutase (Stemcell Technologies, #07920). Cells were then collected by centrifugation at 1200 rpm for 3 minutes and counted before seeding ...
-
No products found
because this supplier's products are not listed.
Lei Peng, et al.,
bioRxiv - Immunology 2021
Quote:
... and PepTivator® SARS-CoV-2 Prot_S Complete peptide pool (Miltenyi Biotec, 15 mers with 11 amino acid overlap) covering the entire SARS-CoV-2 S protein ...
-
No products found
because this supplier's products are not listed.
J. Andrew Duty, et al.,
bioRxiv - Microbiology 2022
Quote:
... Codon optimized SARS-CoV-2 Wuhan Spike carrying the D614G amino acid change (Sino Biological #VG40589-UT(D614G)) was modified to remove the last 21 amino acids at the C-terminus (SpikeΔ21 ...
-
No products found
because this supplier's products are not listed.
Ella J. Gehrke, et al.,
bioRxiv - Genetics 2023
Quote:
... OCT was performed at 2- and 3-weeks post-injection (WPI), then 1- ...
-
An aqueous solution with toluene added as a preservative.
Cat# LS002764,
5 mg, $178.00
Ask
Hirofumi Fujita, Takashi Kodama, Sascha du Lac,
bioRxiv - Neuroscience 2020
Quote:
... Acute bilateral fastigial nuclei were quickly excised with a sharp knife from 2 or 3 cerebellar slices and were then enzymatically digested with cysteine (2 mM)-supplemented papain (40 U/ml, Worthington, Lakewood, NJ) and chondroitinase-ABC (1 U/ml ...
-
No products found
because this supplier's products are not listed.
Qiao Wen Tan, Emmanuel Tan, Marek Mutwil,
bioRxiv - Plant Biology 2024
Quote:
... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
No products found
because this supplier's products are not listed.
Camila de Britto Pará de Aragão, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Data acquisition (filtered at 2–3 kHz and digitized at 15 kHz; Digidata 1440A, Molecular Devices, CA, USA) was performed using the Axopatch 200B amplifier and the Clampex 10.6 software (Molecular Devices) ...
-
No products found
because this supplier's products are not listed.
Chandler Hassan-Casarez, et al.,
bioRxiv - Microbiology 2024
Quote:
... removal by vegetative cells was measured by sampling supernatant and assaying AcA using the change in absorbance at 380 nm in the presence of 2--amino benzamidoxime (ABAO), (as inspired by aldehyde quantifications by Ressmann et. al, 2019) using an Epoch microplate reader (BioTek; Gen5 v3.10 software) [42] ...
-
No products found
because this supplier's products are not listed.
Vaky Abdelsayed, et al.,
bioRxiv - Biophysics 2022
Quote:
... including 2-color and 3-color STORM was performed on an IX83 Inverted microscope (Olympus) using a 100x 1.3NA objective (Olympus) ...
-
No products found
because this supplier's products are not listed.
Sonja Giger, et al.,
bioRxiv - Bioengineering 2021
Quote:
... or 7-Amino-Actinomycin D (7-AAD, Beckman Coulter, B88526) was added to the cell suspensions ...
-
No products found
because this supplier's products are not listed.
Wenchao Li, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... SUMO 2/3 (Proteintech, cat. 11251-1-ap, 1:1000 for WB); Ubiquitin (Proteintech ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Richard B Crouse, et al.,
bioRxiv - Neuroscience 2020
Quote:
... blocked for 2-3 hours (0.3% Triton X-100, American Bioanalytical, Canton, MA; 3% normal donkey serum, Jackson ImmunoResearch, West Grove, PA), then incubated overnight with primary antibodies (1:1000 + 1% normal donkey serum) ...
-
No products found
because this supplier's products are not listed.
Wricha Mishra, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The laser was focused onto layer 2/3 cortex through a 16x water-immersion objective lens (0.8NA, Nikon), and Ca2+ transients were obtained from neuronal populations at a resolution of 512 × 512 pixels (sampling rate ...