-
No products found
because this supplier's products are not listed.
Rick Xing Ze Lu, et al.,
bioRxiv - Bioengineering 2023
Quote:
... along with 5% 2-hydroxy-1-[4(hydyroxyethoxy)phenyl]-2- methyl-1-propane (Irgacure 2959; Sigma-Aldrich) photoinitation ...
-
No products found
because this supplier's products are not listed.
Per Nilsson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 2-hydroxy-5-nitrobenzaldehyde (Acros Organics, #416180050 dissolved in ethanol to 120 mM and centrifuged for one minute at 15,000 rpm to remove insoluble material ...
-
No products found
because this supplier's products are not listed.
Jaakko Haverinen, Minna Hassinen, Matti Vornanen,
bioRxiv - Physiology 2021
Quote:
... L-364,373 (R-L3 or 5-(2-Fluorophenyl)-1,3-dihydro-3-(1H-indol-3-ylmethyl)-1-methyl-2H-1,4-benzodiazepin-2-one) (Tocris Cookson; Bristol, UK) and mefenamic (dimethylphenylaminobenzoic ...
-
No products found
because this supplier's products are not listed.
Stephen R. Garrett, et al.,
bioRxiv - Microbiology 2023
Quote:
... 5 μM 11S and 2 μl furimazine solution (Promega Cat. # N1610) were added and the luminescence read at 1 min intervals for 10 min using the FLUOstar Omega using a gain value of 3,000 ...
-
No products found
because this supplier's products are not listed.
Xinjian Yu, et al.,
bioRxiv - Genomics 2024
Quote:
... included 1.11 μM N7XX (5′-CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTCTCGTGGGCTCGG-3′) and S5XX (5′-AATGATACGGCGACCACCGAGATCTACACXXXXXXXXTCGTCGGCAGCGTC-3′) primers (384PP_AQBP) in 2× HiFi HotStart ReadyMix (Roche, KK2602, 6RES_GPSA). Dual barcode sequences in primers are denoted by “XXXXXXXX.” Unique dual barcode combinations for each well of a 384-well plate were achieved by dispensing 16 unique N7XX barcodes across each row and 24 unique S5XX barcodes across each column ...
-
No products found
because this supplier's products are not listed.
Nienke Willemsen, et al.,
bioRxiv - Pathology 2022
Quote:
... and Proteasome 20S alpha 1+2+3+5+6+7 (Abcam, ab22674). After washing with TBS-T (200 mM Tris (Merck) ...
-
No products found
because this supplier's products are not listed.
Clothilde Philouze, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 1 μCi of 2-Deoxy-D-[1-2-3H] glucose (PerkinElmer, Boston, MA, USA # NET328A001MC) and 10μM non-radioactive 2-DG (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Krzysztof Mikołajczyk,
bioRxiv - Biochemistry 2024
Quote:
... and untransfected cells were cultured for 2 weeks in a complete medium containing 3 μM N-[(1R,2R)-1- (2,3-dihydro-1,4-benzodioxin-6-yl)-1-hydroxy-3-pyrrolidin-1-ylpropan-2-yl]nonanamide (Genz-123346) (Merck, Darmstadt, Germany), a glucosylceramide synthase inhibitor [26].
-
No products found
because this supplier's products are not listed.
Thomas C. Harper, et al.,
bioRxiv - Immunology 2023
Quote:
... 5 ng/ml IL-11 (PeproTech, 200-11), 25 ng/ml IGF-1 (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Qian Chen, et al.,
bioRxiv - Genomics 2020
Quote:
... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
No products found
because this supplier's products are not listed.
Matthew E. Brown, et al.,
bioRxiv - Immunology 2024
Quote:
... or plate-bound 11-CD3 (BioLegend; 2 µg/mL) and plate-bound CD155-Fc (BioLegend ...
-
No products found
because this supplier's products are not listed.
Carlos J. Garcia, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Authentic standards of 3,7-Dihydroxy-5-cholan-24-oic Acid (chenodeoxycholic acid) and 3-Hydroxy-11-oxo-5-cholan-24-oic Acid (3-oxo-chenodeoxycholic acid) were purchased from Avanti Polar Lipids (Alabaster, AL, USA). The N-(3α,7α,12α-trihydroxy-5β-cholan-24-oyl)-glycine (glycocholic acid) ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Jayne E. Wiarda, et al.,
bioRxiv - Immunology 2020
Quote:
... α-CD8α-PE (76-2-11, mouse IgG2a; BD), and α-CD27-FITC (b30c7 ...
-
No products found
because this supplier's products are not listed.
Hannah Elcocks, et al.,
bioRxiv - Cell Biology 2023
Quote:
... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
No products found
because this supplier's products are not listed.
Axel Guilbaud, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 5’-Ethynyl-2’-deoxycytidine and 5’-chloro-2’- deoxycytidine were obtained from Cayman Chemical Company (Ann Arbor ...
-
No products found
because this supplier's products are not listed.
Josette Medicielo, et al.,
bioRxiv - Genomics 2023
Quote:
... and Tetrahydro-2-furoic acid (SC-253674) were obtained from Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Martin P. Steinbuck, et al.,
bioRxiv - Immunology 2020
Quote:
... derived from a peptide scan [15-mers with 11 amino acid overlap] through Spike glycoprotein of SARS-CoV-2) (JPT, Cat: PM-WCPV-5 or GenScript, Cat: RP30020). Phorbol Myristate Acetate (PMA ...
-
No products found
because this supplier's products are not listed.
Ferdinand Althammer, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
Delphine M Depierreux, et al.,
bioRxiv - Microbiology 2021
Quote:
... ULBP-2/5/6 (65903, R&D systems), Plexin-B1 (rea728 ...
-
No products found
because this supplier's products are not listed.
Natasha N. Gaudreault, et al.,
bioRxiv - Microbiology 2021
Quote:
... 11 and 14 DP2C in 2 ml of DMEM (Corning,) with antibiotics/antimycotic (ThermoFisher) ...
-
No products found
because this supplier's products are not listed.
Chi Zhang, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Currents were digitally filtered offline by using a low-pass Gaussian filter with a −3 dB cut-off set to 2 kHz (Clampfit software; pClamp 11, Molecular Devices).
-
No products found
because this supplier's products are not listed.
Amanda N.D. Adams, et al.,
bioRxiv - Microbiology 2021
Quote:
... 200µg/ml 5’-fluoro-2’-deoxyuridine (VWR), 100ng/ml anhydrotetracycline (Sigma) ...
-
No products found
because this supplier's products are not listed.
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Addgene)[70] in a ratio of 5:3:2 using polyethylenimine (24765-2, Polysciences). Virus supernatant was harvested 30 h after transfection ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Mark A. Rutherford, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-diaminobenzidine plus nickel (DAB; Vector Laboratories Kit; 2-5 min reaction). Sections were analyzed with an Olympus BX51 upright microscope ...
-
No products found
because this supplier's products are not listed.
Tereza Kořánová, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PAK1/2/3 (Cell Signaling, #2604), and β-actin (Sigma–Aldrich ...
-
No products found
because this supplier's products are not listed.
Valentina Gandin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... using the following two primer sequences (T7 Forward: 5’-TAATACGACTCACTATAGCGTCATC-3’; Reverse: 5’-TTGTCGCACGTTCGGTGTCG-3’) and purified with DNA Clean and Concentrator-5 Kit (Zymo Research, 11-302). dsDNA was converted to RNA with HiScribe™ T7 High Yield RNA Synthesis Kit (NEB ...
-
No products found
because this supplier's products are not listed.
Sunniyat Rahman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
No products found
because this supplier's products are not listed.
Martineau Éric, et al.,
bioRxiv - Neuroscience 2020
Quote:
... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
No products found
because this supplier's products are not listed.
Cristina Solana-Manrique, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 1% (v/v) ampholytes (pH 3-11 NL; GE Healthcare) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kyle E. Harvey, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Changes in intracellular Ca2+ concentrations were measured by recording the ratio of fluorescence intensities at 508/20 nm resulting from excitation of Fura-2 AM at 340/11 nm or 380/20 nm (center/bandpass) using a Synergy 4 multimode microplate reader (BioTek). Ratios were acquired every 0.7 seconds for 15 seconds before injection and 2 minutes after injection ...
-
No products found
because this supplier's products are not listed.
Kyle A. Campbell, et al.,
bioRxiv - Genomics 2024
Quote:
... The EGFR-Hofbauer/fibroblast fraction was washed and incubated for 10 minutes at 4 °C in the dark with 1:11 REAfinity™ phycoerythrin (PE)-conjugated anti-CD10 antibody (anti-CD10-PE, Miltenyi Biotec, #130-114-5-2, lot #5190109168). The Hofbauer/fibroblast fraction was then washed and incubated for 15 minutes at 4 °C in the dark with 1:5 anti-phycoerythrin MACS® MicroBeads (Miltenyi Biotec ...
-
No products found
because this supplier's products are not listed.
Jitu W. George, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... ALKBH5 (11:1000; 6837-1-AP; Proteintech), and β-actin (1:5000 ...
-
No products found
because this supplier's products are not listed.
Maude Jans, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Fixative was removed by washing 5 x 3 min in 0.1 M cacodylate buffer and samples were incubated in 2% osmium (OsO4, EMS) in 0.1 M cacodylate buffer for 30 min at RT ...
-
No products found
because this supplier's products are not listed.
Simon Maksour, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Embryoid body media (EBM) was used for days 2 to 11 (Supplementary Table 2) and supplemented with 10 µM SB431542 (Stemcell Technologies, #72234), 0.1 µM LDN193189 (MedChemExpress ...
-
No products found
because this supplier's products are not listed.
Itamar Harel, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Samples were spun at 10,000 g for 15 min (spin 2 in the same Eppendorf FA-45-48-11 rotor) and the resulting supernatant is the tissue lysate (TL ...
-
No products found
because this supplier's products are not listed.
Kristin Metzdorf, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 μm thick FFPE sections were stained for SARS-CoV-2 with mouse-anti-nucleocapsid CoV-1/2 (Synaptic Systems, HS-452 11, clone 53E2, subtype: IgG2a) and for macrophages with rat-anti-mouse-MAC2 (Biozol Diagnostica/CEDARLANE,CL8942AP ...
-
No products found
because this supplier's products are not listed.
Voddu Suresh, et al.,
bioRxiv - Microbiology 2021
Quote:
... Sections were incubated with SARS-CoV-2 N protein (Nucleocapsid) (#11-2003; Abgenex, 1:200) or SOD2/Mn-SOD (#NB100-1992; Novus biologicals, 1:100) in a humidified chamber overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Hannah M. Oberle, et al.,
bioRxiv - Neuroscience 2023
Quote:
... breeder pairs from our colony (Figures 2-10) or 5-8 week old male and female C57/Bl6J mice ordered from Jackson labs (Figure 11; stock # 000664). For in vivo experiments with wild-type mice (of either sex) ...
-
No products found
because this supplier's products are not listed.
Hongbing Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 5 mg/mL SARS-CoV-2 spike protein (Sino biological, 40591-V08H) was coated on high binding plates (Corning ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Barbara Acosta-Iborra, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... and 1:10000 goat anti-rabbit-HPR (Jackson ImmunoResearch, 11-035-045). Primary antibodies were incubated overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Olaf Klingbeil, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... LATS1/2 (GeneTex, GTX87014, 1:1,000), p-LATS1/2 (T1079/T1041 ...
-
No products found
because this supplier's products are not listed.
S. L. Fowler, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The top 11 mL and the bottom 2 mL of the gradient were transferred to separate 60 mL 45Ti ultracentrifuge tubes (Beckman), topped up with PBS and centrifuged at 100,000 x g for 70 min at 4°C ...
-
No products found
because this supplier's products are not listed.
William T. Salter, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Two or three of the youngest fully expanded leaves of a single plant were sealed in a 2×6 cm leaf cuvette (Li6400 11; LI-COR, Lincoln, NE, USA) fitted to a LI-COR LI-6400XT gas exchange system to fill the cuvette without overlapping ...
-
No products found
because this supplier's products are not listed.
Zachary Beine, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The primary antibody (2-3% serum, 0.4% PBST, 1:500 Rockland 600-401-379) was applied and incubated for ninety minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Poonam Roshan, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... NFIB (1:2000 in 2% milk, Bethyl), Snail (1:1000 ...