-
No products found
because this supplier's products are not listed.
Nanditha Anandakrishnan, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 0.1% 4-hydroxy benzophenone (Sigma) and 0.1% benzotriazole (Sigma ...
-
No products found
because this supplier's products are not listed.
Meenakumari Muthuramalingam, et al.,
bioRxiv - Biophysics 2020
Quote:
... hexanoyl)-2-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-pentanoyl)-1-hexadecanoyl-sn-glycero-3-phosphoethanolamine) (Invitrogen). Cleavage of PED-6 eliminates a self-quenching effect that results in the release of a BODIPY-FL dye ...
-
No products found
because this supplier's products are not listed.
Luisa Saecker, Hanns Häberlein, Sebastian Franken,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... [2-Amino-4-[3-(trifluoromethyl)phenyl]-3-thienyl] phenylmethanone (VCP 171; Tocris, 1018830-99-3), 5-[2-(5-nitro-2-furanyl)ethenyl]-2-furancarboxylic acid ...
-
No products found
because this supplier's products are not listed.
Pojeong Park, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 4-(3-(cyclopentyloxy)-4-methoxyphenyl)pyrrolidin-2-one (rolipram; Abcam); 4-[(2S)-2-[(5-isoquinolinylsulfonyl)methylamino]-3-oxo-3-(4-phenyl-1-piperazinyl)propyl] phenyl isoquinolinesulfonic acid ester (KN-62 ...
-
No products found
because this supplier's products are not listed.
Nitin Wadhwani, et al.,
bioRxiv - Cancer Biology 2022
Quote:
SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
No products found
because this supplier's products are not listed.
Yuanyuan Wang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
No products found
because this supplier's products are not listed.
Elias Adriaenssens, et al.,
bioRxiv - Cell Biology 2024
Quote:
... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798; RRID:Addgene_223799 ...
-
No products found
because this supplier's products are not listed.
Kentson Lam, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Then 3-(4,5-dimethyl thiazol- 2-yl)-2,5-diphenyl tetrazolium bromide (MTT) labeling reagent (Roche) was added followed by solubilization buffer 2h later ...
-
No products found
because this supplier's products are not listed.
Fumiya Kozawa, et al.,
bioRxiv - Cell Biology 2024
Quote:
... MRS 2211 (2-[(2-chloro-5-nitrophenyl)azo]-5-hydroxy-6- methyl-3-[(phosphonooxy)methyl]-4-pyridinecarboxaldehyde disodium salt and MRS 2395 (2,2-dimethyl-propionic acid 3-(2-chloro-6-methylaminopurin-9- yl)-2-(2,2-dimethyl- propionyloxymethyl)-propyl ester) were obtained from Merck (Darmstadt, Germany).
-
No products found
because this supplier's products are not listed.
Dougald M. Monroe, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 4 μM lipid vesicles (Avanti Polar Lipids PS:PC:PE 3:2:5), and FV (0 ...
-
No products found
because this supplier's products are not listed.
Mei Hong Liu, et al.,
bioRxiv - Genomics 2023
Quote:
... 3 µL 10x NEBuffer 4 (NEB), 3 µL of 1 mM each dATP/ddCTP/ddGTP/ddTTP (dATP/ddBTP ...
-
No products found
because this supplier's products are not listed.
Emily J. Talbot, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
No products found
because this supplier's products are not listed.
Amandine Jarysta, Basile Tarchini,
bioRxiv - Developmental Biology 2021
Quote:
rabbit anti-GNAI1/2/3 (Santa Cruz; sc-262 ...
-
No products found
because this supplier's products are not listed.
Paul-Lennard Mendez, et al.,
bioRxiv - Genomics 2024
Quote:
... SMAD2/3 (SMAD 2/3 XP, Cell Signaling Technology 8685) or isotype control (Rabbit IgG XP ...
-
No products found
because this supplier's products are not listed.
Erik P. Hughes, et al.,
bioRxiv - Immunology 2024
Quote:
... Flow cytometry samples were profiled using a BD Fortessa (BD Biosciences, Fig. 2, 3, 4) or an Aurora spectral flow cytometer (Cytek ...
-
No products found
because this supplier's products are not listed.
Alberto Herrera, et al.,
bioRxiv - Immunology 2024
Quote:
... #3 and #4 (Biolegend) were spiked into individual samples ...
-
No products found
because this supplier's products are not listed.
Lulu Huang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... BMP-2/4) (ERB medium)3 or adding 10 ng/ml human IL-22 (Peprotech) in WENRA4 (Wnt/ R-spondin1 ...
-
No products found
because this supplier's products are not listed.
Margarita Anisimova, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The patch electrodes (3-4 MΩ, World Precision Instruments; 1B150F-3) were filled with intracellular solution containing ...
-
No products found
because this supplier's products are not listed.
Konstantinos Sofiadis, et al.,
bioRxiv - Genomics 2020
Quote:
... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Yao Liu, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Pioglitazone (Takeda Pharmaceuticals) solution was prepared in 1:3 dimethyl sulfoxide (DMSO, Cayman Chemical): phosphate buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Queralt Vallmajo-Martin, et al.,
bioRxiv - Cell Biology 2024
Quote:
... and 3-4 µl of Matrigel (Corning, 356231 ...
-
No products found
because this supplier's products are not listed.
Ana Martín-Leal, et al.,
bioRxiv - Immunology 2020
Quote:
... and detergent removed by adsorption to polystyrene BioBeads SM-2 (3 mg; Bio-Rad; overnight, 4°C). Proteoliposomes were collected by ultracentrifugation (180,000 xg ...
-
No products found
because this supplier's products are not listed.
Rebecca E Schmitt, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Passaging occurred every 3-4 days using ReLeSR (STEMCELL Technologies) and DPBS 1X (Gibco ...
-
No products found
because this supplier's products are not listed.
Gina Partipilo, et al.,
bioRxiv - Bioengineering 2024
Quote:
... disodium;4-[3-pyridin-2-yl-6-(4- sulfonatophenyl)-1,2,4-triazin-5-yl]benzenesulfonate hydrate (Ferrozine, VWR) All media components were autoclaved or sterilized using 0.2 μm PES filters.
-
No products found
because this supplier's products are not listed.
Sebastian Ströh, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2% and 3% OsO4 (prepared from 2 mL 4% osmium tetroxide solution, Electron Microscopy Sciences, Hatfield, PA)
-
No products found
because this supplier's products are not listed.
Sina Ibne Noor, et al.,
bioRxiv - Biochemistry 2020
Quote:
... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
No products found
because this supplier's products are not listed.
Yuting Wang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 2-3 months old male young (Jackson Lab #00664) or 2-3 months old GFP+ male young (Jackson Lab #006567 ...
-
No products found
because this supplier's products are not listed.
Aaron Scholl, et al.,
bioRxiv - Genomics 2024
Quote:
... M anti-DENV NS1 (Type 2/3/4) (Cat# MAB94441-100, R&D Systems), M anti-NXT1 (Cat#67680-1-Ig ...
-
No products found
because this supplier's products are not listed.
Marta E. Stremska, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 μm (#19118-2; Polysciences) or 6 μm (#17145-4 ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Hiroaki Takebe, et al.,
bioRxiv - Microbiology 2024
Quote:
... version 3 (2×300 bp read length; Illumina), following to the manufacturer’s instruction.
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Takashi Handa, Rie Harukuni, Tomoki Fukai,
bioRxiv - Neuroscience 2020
Quote:
... and filled with 2-3% Neurobiotin (Vector Laboratories) dissolved in 0.5 M potassium chloride (9-19 MΩ) ...
-
No products found
because this supplier's products are not listed.
Tulika Singh, et al.,
bioRxiv - Immunology 2021
Quote:
... CD38 APC-AF700 (clone LS198-4-3; Beckman Coulter), CD19 APC-Cy7 (clone SJ25C1 ...
-
No products found
because this supplier's products are not listed.
Ilya Chuykin, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 4-16-cell embryos were transferred to 3 % Ficoll (GE Healthcare) in 0.6x MMR and injected with 5-10 nl of a solution containing mRNAs and/or MOs ...
-
No products found
because this supplier's products are not listed.
Johanna Theruvath, et al.,
bioRxiv - Immunology 2021
Quote:
... 4 minutes after 3 mg d-luciferin (PerkinElmer) was injected intraperitoneally ...
-
No products found
because this supplier's products are not listed.
Katharina Best, et al.,
bioRxiv - Biochemistry 2022
Quote:
... R3/3 copper grids with a 2 nm carbon coating (Quantifoil) using a Vitrobot mark IV (FEI ...
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004185,
Bulk, Inquire
Ask
Faten A. Sayed, et al.,
bioRxiv - Neuroscience 2020
Quote:
... incubated with 3% collagenase type 3 (Worthington), 3 U/ml dispase (Worthington ...
-
No products found
because this supplier's products are not listed.
Xin-Miao Zhang, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... B-cell lymphoma-2 associated X protein antibody (Bax, 60267-1-Ig), and cysteinyl aspartate specific puroteinase-3 antibody (Caspase-3, 66470-2-Ig) were purchased from Proteintech (Wuhan, China), and the p53 antibody (Ab131442) ...
-
No products found
because this supplier's products are not listed.
Qiao Wen Tan, Emmanuel Tan, Marek Mutwil,
bioRxiv - Plant Biology 2024
Quote:
... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
No products found
because this supplier's products are not listed.
Valentina Salvi, et al.,
bioRxiv - Immunology 2021
Quote:
... and PE-conjugated anti-IL-4 (clone 7A3-3, Miltenyi Biotec) following the manufacturer’s recommendations ...
-
No products found
because this supplier's products are not listed.
Corey M. Griffith, et al.,
bioRxiv - Biochemistry 2024
Quote:
... non-targeting sgRNA (TGCTTTACCGCGTTGGGTAA) or CLYBL targeting sgRNA (exon 2: CATAGAGCACTGCTCTCCGG; exon 3: AGACTTTGACCTGGGCACAA; exon 4: CCATTGCAGTCTCCACAAAG) were purchased from Genscript. Plasmids were transformed into OneShot™ E ...
-
No products found
because this supplier's products are not listed.
Piyush Daga, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4% (3-Aminopropyl)triethoxysilane(APTES)-treated and 2% glutaraldehyde-activated glass-bottom dishes (Ibidi) were used to cast polyacrylamide (PAA ...
-
No products found
because this supplier's products are not listed.
Lara Taniguchi, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Borosilicate glass pipettes (3–4 MΩ, Molecular Devices) filled with internal solution (295–305 mOsm ...
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... Cortical layers 2/3 and 4 neurons were visualized by using an upright microscope and camera system (BX51WIF, Olympus, and SciCam Pro CCD camera ...
-
No products found
because this supplier's products are not listed.
Steven Tau, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Plates were imaged every 3-4 d on a Cytation 5 (BioTek) with 4x magnification and phase contrast ...
-
No products found
because this supplier's products are not listed.
Richard B Crouse, et al.,
bioRxiv - Neuroscience 2020
Quote:
... blocked for 2-3 hours (0.3% Triton X-100, American Bioanalytical, Canton, MA; 3% normal donkey serum, Jackson ImmunoResearch, West Grove, PA), then incubated overnight with primary antibodies (1:1000 + 1% normal donkey serum) ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Hela Benaissa, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Image stacks were obtained at 2-or 3-min intervals either with a 10× objective (CFI Plan APO LBDA, NA 0.45, Nikon; z-step = 4 μm) or a 100× oil immersion objective (APO VC ...
-
No products found
because this supplier's products are not listed.
Yali Zhang, et al.,
bioRxiv - Microbiology 2020
Quote:
... SARS-CoV2-S1 (Sino Biological, 40591-V08H, n=3) and SARS-CoV2-S2 (Sino Biological ...