-
No products found
because this supplier's products are not listed.
Axel Chemla, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 2-Chloroquinoline-3-carboxylic acid (Sigma-Aldrich, cat. no 688517), 4-Chloro-DL-phenylalanine salt (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Matilda Shackley, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 2-(4-chlorophenyl)-3-methyl-N-(thiazole-2-yl)butanamide (4-CMTB; Tocris) was used as a FFAR2-specific agonist and AR420626 (Cayman ...
-
No products found
because this supplier's products are not listed.
Blanca Soler Palacios, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 µl of Dynabeads MyOne Carboxylic Acid (1 μm; ThermoFisher Scientific) were added at a concentration of 0.5 mg/ml to each of the samples ...
-
No products found
because this supplier's products are not listed.
Yangyang Zhang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... C-175) and 3-((2-methyl-1,3-thiazol-4-yl)ethynyl)pyridine hydrochloride (MTEP hydrochloride, Abcam, ab120035) were prepared in distilled water and diluted with saline to the required concentration.
-
No products found
because this supplier's products are not listed.
Dounia Dems, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Fmoc-(4-amino)benzoic acid and Fmoc-(4-aminomethyl)benzoic acid were purchased from VWR and Chem-Impex International Inc. ...
-
No products found
because this supplier's products are not listed.
Samuel Shields, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 100 µM Trolox ([±]-6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid; Merck), 100 µM nocodazole and 1 nM NAP (a gift from Illana Gozes ...
-
No products found
because this supplier's products are not listed.
Anika J. Friedman, et al.,
bioRxiv - Biochemistry 2022
Quote:
... and 2-[(Carboxy-carbonyl)amino]-4,5,6,7-tetrahydrothieno[2,3-c]pyridine-3-carboxylic acid hydrochloride (TCS 401) from Cayman Chemical (Ann Arbor, Michigan) and Ertiprotafib from Med-Koo Biosciences ...
-
No products found
because this supplier's products are not listed.
Vaishali Aggarwal, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... P4HA2 was inhibited by using 20 μmol/L 1,4-dihydrophenonthrolin-4-one-3-carboxylic acid (1,4-DPCA) (SC-200758, Santa Cruz, USA). 1,4-DPCA ...
-
No products found
because this supplier's products are not listed.
Nitin Wadhwani, et al.,
bioRxiv - Cancer Biology 2022
Quote:
SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
No products found
because this supplier's products are not listed.
Saori Shinoda, et al.,
bioRxiv - Cell Biology 2024
Quote:
... and 1,2-dioleoyl-sn-glycero-3-phospho-(1′-myo-inositol-3′,4′-bisphosphate) (18:1 PI(3,4)P2) (850153P; Avanti Polar Lipids) dissolved in chloroform to 1 µM final concentrations were mixed in a glass tube at the indicated ratios in the figure legends ...
-
No products found
because this supplier's products are not listed.
Wyatt E. Lanik, et al.,
bioRxiv - Cell Biology 2020
Quote:
... with 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Corning) supplemented with 10% heat inactivated fetal bovine serum (Sigma) ...
-
No products found
because this supplier's products are not listed.
Ku-Feng Lin, et al.,
bioRxiv - Biochemistry 2020
Quote:
... supplemented with protease inhibitors (4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (Roche), benzamidine ...
-
No products found
because this supplier's products are not listed.
Li-Jin Chan, et al.,
bioRxiv - Microbiology 2020
Quote:
... 100 μl thiazole orange (TO) (Retic-Count Reagent; BD Biosciences) was added and incubated for half an hour ...
-
No products found
because this supplier's products are not listed.
Florence E. McLean, et al.,
bioRxiv - Microbiology 2024
Quote:
... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) 25 mM (Lonza, 17-737F), gentamicin 25 μg/ml (Lonza ...
-
No products found
because this supplier's products are not listed.
Elias Adriaenssens, et al.,
bioRxiv - Cell Biology 2024
Quote:
... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798; RRID:Addgene_223799 ...
-
No products found
because this supplier's products are not listed.
Zhenxing Zhong, et al.,
bioRxiv - Cell Biology 2024
Quote:
... packaging vectors at a ratio of 4:3:1 using polyethyleneimine (PEI, Polysciences, #23966-2). Virus-containing medium was collected at 48 and 72 hours post-transfection ...
-
No products found
because this supplier's products are not listed.
Jason Sims, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Magnetic beads (Dynabeads M-270 Carboxylic Acid) were activated and coated with ad hoc designed LNA probes (Qiagen), harboring an −NH2 group ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Alexa C. Cannon, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... PAK 1/2/3 1:1000 (Cell Signaling Technology Cat# 2604, RRID:AB_2160225), Myc-Tag 1:1000 (Cell Signaling Technology Cat# 2276 ...
-
No products found
because this supplier's products are not listed.
Azharul Islam, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 4′6-diamidino-2-phenylindole hydrochloride (Vector Laboratories). More than 20 randomly selected fields of view per sample were photographed using a WHN10×/22 eyepiece and a 60× objective (field of view is 1.1 mm ...
-
No products found
because this supplier's products are not listed.
Magdalena A. Sutcliffe, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... and the NEBNext Multiplex Oligos from Illumina (Index Primers Set 1, 2, 3 and 4, NEB, E7335S, E7500S, E7710S, E7730S), following the manufacturer’s protocols ...
-
No products found
because this supplier's products are not listed.
M. Eugenia Dieterle, et al.,
bioRxiv - Microbiology 2020
Quote:
... coated with PBS alone or with 2 µg/ml of SARS-CoV-2 S protein in PBS overnight at 4°C were blocked for 1 hour with 3% nonfat dry milk (Biorad) in PBS ...
-
No products found
because this supplier's products are not listed.
Sebastian Ströh, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2% and 3% OsO4 (prepared from 2 mL 4% osmium tetroxide solution, Electron Microscopy Sciences, Hatfield, PA)
-
No products found
because this supplier's products are not listed.
Icaro Putinhon Caruso, et al.,
bioRxiv - Biophysics 2021
Quote:
... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
No products found
because this supplier's products are not listed.
Sara Zalghout, et al.,
bioRxiv - Pathology 2021
Quote:
... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
No products found
because this supplier's products are not listed.
Juan Qin, et al.,
bioRxiv - Biochemistry 2021
Quote:
... PKAc was immobilized via standard N-hydroxysuccinimide (NHS) / 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) amine coupling on a CM5 (carboxyl methyl dextran) sensor chip (GE Healthcare). Before covalent immobilization of PKAc ...
-
No products found
because this supplier's products are not listed.
Emily J. Talbot, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
No products found
because this supplier's products are not listed.
Michael S. Haney, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Cells were incubated in PBS with 3% donkey serum and the following primary antibodies overnight at 4 °C: rabbit anti-Perilipin 2 (1:200; Proteintech 15294-1-AP), rabbit anti-ACSL1 (1:100 ...
-
No products found
because this supplier's products are not listed.
Laura K. Cole, et al.,
bioRxiv - Biochemistry 2021
Quote:
... or 0.1 μM [1-14C]linoleic acid (2 μCi/dish, Perkin Elmer) bound to albumin (1:1 molar ratio ...
-
No products found
because this supplier's products are not listed.
Biren M. Dave, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... differentiating cells were confluent again and split 1:3-1:4 into Step 2 differentiation medium: BrainPhys Neuronal Medium (STEMCELL Technologies, cat# 05790), 1X N2 ...
-
No products found
because this supplier's products are not listed.
Aaron Scholl, et al.,
bioRxiv - Genomics 2024
Quote:
... M anti-DENV NS1 (Type 2/3/4) (Cat# MAB94441-100, R&D Systems), M anti-NXT1 (Cat#67680-1-Ig ...
-
No products found
because this supplier's products are not listed.
Lulu Huang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... BMP-2/4) (ERB medium)3 or adding 10 ng/ml human IL-22 (Peprotech) in WENRA4 (Wnt/ R-spondin1 ...
-
No products found
because this supplier's products are not listed.
Derek Schaeuble, et al.,
bioRxiv - Neuroscience 2023
Quote:
... tissue was blocked again (4% BSA, 3% donkey serum, 0.1% Triton) for 1 hour before incubation in synaptobrevin-2 primary antibody (Synaptic Systems; 104 211C3) (1:200 in blocking solution ...
-
No products found
because this supplier's products are not listed.
Sladjana Skopelja-Gardner, et al.,
bioRxiv - Immunology 2020
Quote:
... Initial experiments were conducted using both male and female C57BL/6J mice (Jackson Labs, 3-4 months old, Figs. 1-2). Female mice were used for all subsequent experiments ...
-
No products found
because this supplier's products are not listed.
Sergio P. Alpuche-Lazcano, et al.,
bioRxiv - Microbiology 2023
Quote:
The pEGFP-C1 plasmids including AFF4 3’UTR sites “1-2-3” were generated using pEGFP-C1 (Clontech). The following complementary oligonucleotides were annealed in respective pairs as above (1.25 µM each in 75 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Corey M. Griffith, et al.,
bioRxiv - Biochemistry 2024
Quote:
... non-targeting sgRNA (TGCTTTACCGCGTTGGGTAA) or CLYBL targeting sgRNA (exon 2: CATAGAGCACTGCTCTCCGG; exon 3: AGACTTTGACCTGGGCACAA; exon 4: CCATTGCAGTCTCCACAAAG) were purchased from Genscript. Plasmids were transformed into OneShot™ E ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Cathy C. Garcia, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Slides were incubated at 4°C with primary (Day 1) and secondary (Day 2) antibodies (Jackson ImmunoResearch) overnight in PBT and 5% donkey serum in a humidified chamber and washed three times for 10 min after each antibody incubation with PBT ...
-
No products found
because this supplier's products are not listed.
Karthikeyan Thirugnanam, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Smad 2/3 (Novus Biologicals, Cat# AF3797, 1:200 dilution), GAPDH (Santa Cruz ...
-
A partially purified powder. Suitable as a substrate for hyaluronidase assays.
Cat# LS003911,
Bulk, Inquire
Ask
Chunlei Cang, Boxun Lu, Dejian Ren,
bioRxiv - Physiology 2020
Quote:
... 4 mg collagenase type 2 (Worthington) and 1.5 mg trypsin (Worthington) ...
-
No products found
because this supplier's products are not listed.
Wenjian Lv, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cells were passaged (1:12) every 3-4 days using StemMACS Passaging Solution XF (Miltenyi Biotec) and Y-27632 dihydrochloride (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Tulika Singh, et al.,
bioRxiv - Immunology 2021
Quote:
... CD38 APC-AF700 (clone LS198-4-3; Beckman Coulter), CD19 APC-Cy7 (clone SJ25C1 ...
-
No products found
because this supplier's products are not listed.
Chengyuan Wang, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Samples (3 μl) were applied to Quantifoil 2/1 Cu 300 holey-carbon grids (Quantifoil) glow-discharged 60 s using a PELCO glow-discharge system (Ted Pella) ...
-
No products found
because this supplier's products are not listed.
Hiroaki Takebe, et al.,
bioRxiv - Microbiology 2024
Quote:
... version 3 (2×300 bp read length; Illumina), following to the manufacturer’s instruction.
-
No products found
because this supplier's products are not listed.
Sawsan S Alamri, et al.,
bioRxiv - Immunology 2021
Quote:
... were coated overnight at 4°C with the SARS-CoV-2 S1 subunit (amino acids 1–685) (Sino Biological, China) at 1 μg/ml in PBS (50 ul/well) ...
-
No products found
because this supplier's products are not listed.
Raianna F. Fantin, et al.,
bioRxiv - Immunology 2024
Quote:
... Plates were developed for 10 minutes at room temperature and then the reaction was stopped by adding 50 μL 3 M hydrochloric acid (HCl, Fisher) and plates were read using a Synergy 4 (BioTek) plate reader at an optical density (OD ...
-
No products found
because this supplier's products are not listed.
Eleonora Grisard, et al.,
bioRxiv - Cell Biology 2021
Quote:
... rabbit anti-human 14-3-3 1/1000 (EPR6380, GeneTex), rabbit anti-human Lamp1 1/1000 (clone EPR4204 ...
-
No products found
because this supplier's products are not listed.
Zachary Beine, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The primary antibody (2-3% serum, 0.4% PBST, 1:500 Rockland 600-401-379) was applied and incubated for ninety minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Matthew S.J. Mangan, et al.,
bioRxiv - Immunology 2021
Quote:
... Rac1/2/3 (1:1000, rabbit polyclonal #2465) from CST, actin (mouse or rabbit, both 1:1,000 dilution) from LI-COR Biosciences ...
-
No products found
because this supplier's products are not listed.
Ida Paciello, et al.,
bioRxiv - Immunology 2024
Quote:
... 3 µg ml-1 of SARS-CoV-2 subunits diluted in carbonate-bicarbonate buffer (E107, Bethyl Laboratories), were coated in 384-well plates (microplate clear ...