-
No products found
because this supplier's products are not listed.
Sujeewa S. Lellupitiyage Don, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 3% 2-Hydroxyethyl Agarose (Sigma) was prepared and stored in a water bath at 45 °C ...
-
No products found
because this supplier's products are not listed.
Ian T Lobb, et al.,
bioRxiv - Cell Biology 2020
Quote:
... SUMO-2/3 (Invitrogen); β-Catenin (BD Transduction Laboratories) ...
-
No products found
because this supplier's products are not listed.
Mara Doimo, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2’,3’-dideoxycytidine (ddC, Abcam) was freshly dissolved in distilled water to 100 mM prior to cell treatment ...
-
No products found
because this supplier's products are not listed.
Neha Nanajkar, et al.,
bioRxiv - Biophysics 2024
Quote:
... composed of 3:1 1palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC): 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoL-serine (POPS) (Avanti Polar Lipids, Alabaster, AL) were prepared using extrusion and sonication methods ...
-
No products found
because this supplier's products are not listed.
Maria-Luisa del Rio, et al.,
bioRxiv - Immunology 2024
Quote:
... and 2 mg/ml 3-[4,5-dimethylthiazol-2-yl]-5-[3-carboxymethoxyphenyl]2-[4-sulfophenyl]-2H-tetrazolium (PMS, Promega) (1/20 ...
-
No products found
because this supplier's products are not listed.
Paul-Lennard Mendez, et al.,
bioRxiv - Genomics 2024
Quote:
... SMAD2/3 (SMAD 2/3 XP, Cell Signaling Technology 8685) or isotype control (Rabbit IgG XP ...
-
No products found
because this supplier's products are not listed.
Tudor Selescu, et al.,
bioRxiv - Physiology 2024
Quote:
... N-(3-aminopropyl)-2-{[(3-methylphenyl)methyl]oxy}-N-(2-thienylmethyl)benzamide hydrochloride salt (AMTB, Tocris #3989) 10 mM in H2O ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Vakil Takhaveev, et al.,
bioRxiv - Genomics 2024
Quote:
... and 2 µL 10x NEBuffer 3 (NEB) in a total volume of 20 µL and was incubated for 40 min at 37 °C and 60 min at 45 °C ...
-
No products found
because this supplier's products are not listed.
Rutger D. Luteijn, et al.,
bioRxiv - Immunology 2022
Quote:
... 2′3′- cyclic-di-GMP-AMP (2′3′-cGAMP) (Invivogen cat. no. tlrl-nacga23), and human IFN-β (PeproTech ...
-
No products found
because this supplier's products are not listed.
Amandine Jarysta, Basile Tarchini,
bioRxiv - Developmental Biology 2021
Quote:
rabbit anti-GNAI1/2/3 (Santa Cruz; sc-262 ...
-
No products found
because this supplier's products are not listed.
Philipp Wahle, et al.,
bioRxiv - Systems Biology 2022
Quote:
... 2 x 3’ Neoclear (Merck), 2 x 3 ‘ 100% ETOH ...
-
No products found
because this supplier's products are not listed.
Pata-Eting Kougnassoukou Tchara, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 3 µg of psPAX.2 (Addgene, #12260), and 3 µg of sgRNA plasmid into HEK293T cells seeded in 6-well plates at 70% confluence using jetPRIME transfection reagent according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Patrick O. Byrne, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... IgG(1/2/3)-FITC (BD Pharmingen), and IgM-PE-Cy7 (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
Jin-Woong Heo, et al.,
bioRxiv - Physiology 2023
Quote:
... for 2□min and 3% lead citrate (EMS, 22410) for 1□min ...
-
No products found
because this supplier's products are not listed.
Konstantinos Sofiadis, et al.,
bioRxiv - Genomics 2020
Quote:
... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Yuting Wang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 2-3 months old male young (Jackson Lab #00664) or 2-3 months old GFP+ male young (Jackson Lab #006567 ...
-
No products found
because this supplier's products are not listed.
Yu H. Sun, et al.,
bioRxiv - Genomics 2020
Quote:
... This mixture was aliquoted in 2-3 cryovials (Corning, NY), secured on an aluminum cryocane ...
-
No products found
because this supplier's products are not listed.
Ravikanth Maddipati, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
No products found
because this supplier's products are not listed.
Amanda J Eakin, et al.,
bioRxiv - Cell Biology 2020
Quote:
... rat anti-mouse Mac-2 (Galectin-3, 125402, Biolegend) for myeloid cells (Ho and Springer 1982) ...
-
No products found
because this supplier's products are not listed.
Kamal L Nahas, et al.,
bioRxiv - Cell Biology 2021
Quote:
3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ...
-
No products found
because this supplier's products are not listed.
Hiroaki Takebe, et al.,
bioRxiv - Microbiology 2024
Quote:
... version 3 (2×300 bp read length; Illumina), following to the manufacturer’s instruction.
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Belen Calles, Borja Pitarch, Víctor de Lorenzo,
bioRxiv - Microbiology 2024
Quote:
... 2 µg/ml of glycerol 3-phosphate dehydrogenase (Roche) and 5 µg of cell free protein extract ...
-
No products found
because this supplier's products are not listed.
Ahmed M. Fahmy, et al.,
bioRxiv - Immunology 2023
Quote:
... 2’’3’’-cGAMP ELISA was done using the 2’’3’’-cGAMP ELISA Kit (Cayman Chemical Co.) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Giulio Donati, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 2 ng/mL murine interleukin 3 (PeproTech, Rocky Hill, NJ, USA). Prior to experiments involving IACS-010759 ...
-
No products found
because this supplier's products are not listed.
Marta E. Stremska, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 μm (#19118-2; Polysciences) or 6 μm (#17145-4 ...
-
No products found
because this supplier's products are not listed.
Aneela Nomura, et al.,
bioRxiv - Immunology 2023
Quote:
... 2 ng/mL of IL-2 and 3 ng/mL of TGFβ (R&D systems, 7666-MB-055)) conditions ...
-
No products found
because this supplier's products are not listed.
Jacob P. Fredrikson, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The devices were plasma bonded to 3 x 2 in glass slides (VWR) for drop makers and 25 x 25 mm type 0 coverslips (VWR ...
-
No products found
because this supplier's products are not listed.
Sina Ibne Noor, et al.,
bioRxiv - Biochemistry 2020
Quote:
... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
No products found
because this supplier's products are not listed.
Takashi Handa, Rie Harukuni, Tomoki Fukai,
bioRxiv - Neuroscience 2020
Quote:
... and filled with 2-3% Neurobiotin (Vector Laboratories) dissolved in 0.5 M potassium chloride (9-19 MΩ) ...
-
No products found
because this supplier's products are not listed.
Ella J. Gehrke, et al.,
bioRxiv - Genetics 2023
Quote:
... OCT was performed at 2- and 3-weeks post-injection (WPI), then 1- ...
-
No products found
because this supplier's products are not listed.
Damien Detraux, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Cells were passaged every 2-3 days using accutase (Stemcell Technologies, #07920). Cells were then collected by centrifugation at 1200 rpm for 3 minutes and counted before seeding ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004185,
Bulk, Inquire
Ask
Hirofumi Fujita, Takashi Kodama, Sascha du Lac,
bioRxiv - Neuroscience 2020
Quote:
... Acute bilateral fastigial nuclei were quickly excised with a sharp knife from 2 or 3 cerebellar slices and were then enzymatically digested with cysteine (2 mM)-supplemented papain (40 U/ml, Worthington, Lakewood, NJ) and chondroitinase-ABC (1 U/ml ...
-
No products found
because this supplier's products are not listed.
Suphia Rafique,
bioRxiv - Plant Biology 2021
Quote:
... 100 mM DTT and 2% v/v IPG buffer pH 3– 10 (GE Healthcare) was applied to the strips ...
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
No products found
because this supplier's products are not listed.
Sarah Hyllekvist Jørgensen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and AKT 1/2/3 (p-S473) Assay Kits (PerkinElmer). Cell lysis and SureFire Assay were performed following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Christos Georgiadis, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3% human serum (Seralab) +20 ng/ml human recombinant IL-2 (Miltenyi Biotec) and activated with TransAct reagent (Miltenyi Biotec) ...
-
No products found
because this supplier's products are not listed.
Qiao Wen Tan, Emmanuel Tan, Marek Mutwil,
bioRxiv - Plant Biology 2024
Quote:
... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
No products found
because this supplier's products are not listed.
Camila de Britto Pará de Aragão, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Data acquisition (filtered at 2–3 kHz and digitized at 15 kHz; Digidata 1440A, Molecular Devices, CA, USA) was performed using the Axopatch 200B amplifier and the Clampex 10.6 software (Molecular Devices) ...
-
No products found
because this supplier's products are not listed.
Camille Danne, et al.,
bioRxiv - Immunology 2022
Quote:
Mice were administered drinking water supplemented with 2-3% (wt/vol) DSS (MP Biomedicals) for 5-7 days (depending on colitis severity of each experiment) ...
-
No products found
because this supplier's products are not listed.
Vaky Abdelsayed, et al.,
bioRxiv - Biophysics 2022
Quote:
... including 2-color and 3-color STORM was performed on an IX83 Inverted microscope (Olympus) using a 100x 1.3NA objective (Olympus) ...
-
No products found
because this supplier's products are not listed.
Wenchao Li, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... SUMO 2/3 (Proteintech, cat. 11251-1-ap, 1:1000 for WB); Ubiquitin (Proteintech ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Richard B Crouse, et al.,
bioRxiv - Neuroscience 2020
Quote:
... blocked for 2-3 hours (0.3% Triton X-100, American Bioanalytical, Canton, MA; 3% normal donkey serum, Jackson ImmunoResearch, West Grove, PA), then incubated overnight with primary antibodies (1:1000 + 1% normal donkey serum) ...
-
No products found
because this supplier's products are not listed.
Wricha Mishra, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The laser was focused onto layer 2/3 cortex through a 16x water-immersion objective lens (0.8NA, Nikon), and Ca2+ transients were obtained from neuronal populations at a resolution of 512 × 512 pixels (sampling rate ...
-
No products found
because this supplier's products are not listed.
Anna Ruzhanskaya, et al.,
bioRxiv - Biochemistry 2020
Quote:
... One was through twice daily measurement of 2 or 3 levels of QC specimens obtained from Beckman Coulter Inc ...
-
No products found
because this supplier's products are not listed.
Adrian W Hodel, et al.,
bioRxiv - Immunology 2024
Quote:
... turbidity was monitored in 2-minute intervals at 600 nm absorption using a Cytation 3 plate reader (BioTek, Agilent Technologies ...
-
No products found
because this supplier's products are not listed.
Juwel Chandra Baray, et al.,
bioRxiv - Immunology 2020
Quote:
... The plate was washed for 3 times then incubated with mouse sera and SARS-CoV-2 Spike antibody (Sino Biological, China) for 2 hours at 37 °C ...