-
No products found
because this supplier's products are not listed.
Jack Whitewolf, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 5-norbornene-2-carboxylic acid (Sigma) was then added to the solution ...
-
No products found
because this supplier's products are not listed.
Logan D. Morton, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 5-norbornene-2-carboxylic acid (99%, Fisher Scientific) (12:1 to HA-TBA repeat unit) ...
-
No products found
because this supplier's products are not listed.
Tudor Selescu, et al.,
bioRxiv - Physiology 2024
Quote:
... 4-(3-chloro-pyridin-2-yl)-piperazine-1-carboxylic acid (4-tert-butyl-phenyl)-amide (BCTC, Tocris #3875) 10 mM in DMSO ...
-
No products found
because this supplier's products are not listed.
Nitin Wadhwani, et al.,
bioRxiv - Cancer Biology 2022
Quote:
SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
No products found
because this supplier's products are not listed.
Romain D. Cazé, et al.,
bioRxiv - Neuroscience 2023
Quote:
D-AP5 (D-(−)-2-Amino-5-phosphonopentanoic acid) and SR 95531 (2-(3-Carboxypropyl)-3-amino-6-(4 methoxyphenyl) pyridazinium bromide) were purchased from Abcam, UK ...
-
No products found
because this supplier's products are not listed.
Samuel Shields, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 100 µM Trolox ([±]-6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid; Merck), 100 µM nocodazole and 1 nM NAP (a gift from Illana Gozes ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Hiroyuki Mori, et al.,
bioRxiv - Physiology 2020
Quote:
... 5-(tetradecyloxy)-2-furoic acid (TOFA) (Cayman Chemical)
-
No products found
because this supplier's products are not listed.
Konstadinos Moissoglu, et al.,
bioRxiv - Cell Biology 2020
Quote:
... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Patrick T Griffin, et al.,
bioRxiv - Genomics 2022
Quote:
... and 2 μl of Klenow Fragment (3’→5’ exo-) (M0212L, NEB). The reactions were incubated at 37ºC for 30 minutes and then cleaned up with a Clean and Concentrate-25 column (Zymo) ...
-
No products found
because this supplier's products are not listed.
Dougald M. Monroe, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 4 μM lipid vesicles (Avanti Polar Lipids PS:PC:PE 3:2:5), and FV (0 ...
-
No products found
because this supplier's products are not listed.
Gina Partipilo, et al.,
bioRxiv - Bioengineering 2024
Quote:
... disodium;4-[3-pyridin-2-yl-6-(4- sulfonatophenyl)-1,2,4-triazin-5-yl]benzenesulfonate hydrate (Ferrozine, VWR) All media components were autoclaved or sterilized using 0.2 μm PES filters.
-
No products found
because this supplier's products are not listed.
Anastasia Selyutina, et al.,
bioRxiv - Microbiology 2020
Quote:
... supplemented with 5 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (Corning, Corning, NY, USA), 50 μg/ml penicillin/streptomycin (Corning) ...
-
No products found
because this supplier's products are not listed.
Vaishali Aggarwal, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... P4HA2 was inhibited by using 20 μmol/L 1,4-dihydrophenonthrolin-4-one-3-carboxylic acid (1,4-DPCA) (SC-200758, Santa Cruz, USA). 1,4-DPCA ...
-
No products found
because this supplier's products are not listed.
Ashwin Narayanan, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... concentrations was assessed using reduction in WST-1 (4-[3-(4-Iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]- 1,3-benzene Disulfonate) to water-soluble formazan (Roche, France). Cells were seeded in 96-well plates at 2 × 104 cells/well and treated with the different NAM concentrations at 37°C ...
-
No products found
because this supplier's products are not listed.
Florence E. McLean, et al.,
bioRxiv - Microbiology 2024
Quote:
... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) 25 mM (Lonza, 17-737F), gentamicin 25 μg/ml (Lonza ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
Ashley N. Anderson, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... followed by 3 x 5 minute washes in 2 × SSC (BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Angela Armento, et al.,
bioRxiv - Cell Biology 2024
Quote:
... bFGF 5 ng/ml (day 2-4, AF-100-18B, Peprotech), activinA 100 ng/ml (day 4-14 ...
-
No products found
because this supplier's products are not listed.
Ferdinand Althammer, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
No products found
because this supplier's products are not listed.
Stephanie S. Kim, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ...
-
No products found
because this supplier's products are not listed.
Sebastian Ströh, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2% and 3% OsO4 (prepared from 2 mL 4% osmium tetroxide solution, Electron Microscopy Sciences, Hatfield, PA)
-
No products found
because this supplier's products are not listed.
Mark A. Rutherford, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-diaminobenzidine plus nickel (DAB; Vector Laboratories Kit; 2-5 min reaction). Sections were analyzed with an Olympus BX51 upright microscope ...
-
No products found
because this supplier's products are not listed.
Tereza Kořánová, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PAK1/2/3 (Cell Signaling, #2604), and β-actin (Sigma–Aldrich ...
-
No products found
because this supplier's products are not listed.
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Addgene)[70] in a ratio of 5:3:2 using polyethylenimine (24765-2, Polysciences). Virus supernatant was harvested 30 h after transfection ...
-
No products found
because this supplier's products are not listed.
Martineau Éric, et al.,
bioRxiv - Neuroscience 2020
Quote:
... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
No products found
because this supplier's products are not listed.
Paul Renauer, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 4 x 2 mm (Phenomenex). The eluents were A ...
-
No products found
because this supplier's products are not listed.
Sunniyat Rahman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
No products found
because this supplier's products are not listed.
GaYoung Park, et al.,
bioRxiv - Bioengineering 2024
Quote:
... hydrogels of varying Young’s modulus: 5 kPa (4% 20 kDa 4-arm PEG-NB, Creative PEGworks; 2 mM RGD, Genscript), 12 kPa (5% 40 kDa 8-arm PEG-NB ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Yoann Daniel, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... [2-14C] acetic acid (Perkin Elmer, NEC553050UC) and 50 µM cold acetic acid (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Mario Mietzsch, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 3.5 μL was applied to a glow-discharged Quantifoil copper grid with 2 nm continuous carbon support over holes (Quantifoil R 2/4 400 mesh), blotted ...
-
No products found
because this supplier's products are not listed.
Laísa Quadros Barsé, et al.,
bioRxiv - Biochemistry 2024
Quote:
... The resulting filtrate was loaded onto 2 × 5 ml nickel–nitrilotriacetic acid (Ni–NTA) columns “HisTrapTM HP” (GE Healthcare) equilibrated with lysis buffer 2 ...
-
No products found
because this supplier's products are not listed.
Yuting Wang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 2-3 months old male young (Jackson Lab #00664) or 2-3 months old GFP+ male young (Jackson Lab #006567 ...
-
No products found
because this supplier's products are not listed.
Icaro Putinhon Caruso, et al.,
bioRxiv - Biophysics 2021
Quote:
... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
No products found
because this supplier's products are not listed.
Zhihui Liu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... with patch pipettes (2-3 MΩ) pulled from borosilicate pipettes (TW150-4, WPI, USA) using PC-10 puller (Narishige ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Ludovic Enkler, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2% (w/v) glucose and mixtures of amino acids (MP Biomedicals) depending on the auxotrophies used for selection ...
-
No products found
because this supplier's products are not listed.
Nicolò Mangraviti, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and 5 ng/ml human FGF-2 (Miltenyi Biotec). Then ...
-
No products found
because this supplier's products are not listed.
Piyush Daga, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4% (3-Aminopropyl)triethoxysilane(APTES)-treated and 2% glutaraldehyde-activated glass-bottom dishes (Ibidi) were used to cast polyacrylamide (PAA ...
-
No products found
because this supplier's products are not listed.
Sawsan S Alamri, et al.,
bioRxiv - Immunology 2021
Quote:
... were coated overnight at 4°C with the SARS-CoV-2 S1 subunit (amino acids 1–685) (Sino Biological, China) at 1 μg/ml in PBS (50 ul/well) ...
-
No products found
because this supplier's products are not listed.
Zac Chatterton, et al.,
bioRxiv - Genomics 2022
Quote:
... 0.25 μL of Proteinase K (Zymo, D3001-2-5), and 2.5μL of H2O ...
-
No products found
because this supplier's products are not listed.
Steven Tau, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Plates were imaged every 3-4 d on a Cytation 5 (BioTek) with 4x magnification and phase contrast ...
-
No products found
because this supplier's products are not listed.
Marco Troisi, et al.,
bioRxiv - Immunology 2023
Quote:
... Bacteria cultures were collected and discarded by centrifugation for 60 min at 4,000-8,000 x g and the supernatants were subjected to high-speed centrifugation at 11,9000 x g for 2-3 h at 4°C (Beckman Coulter Optima Ultracentrifuge). The pellets containing the OMVs were washed with PBS ...
-
No products found
because this supplier's products are not listed.
Damien Detraux, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Cells were passaged every 2-3 days using accutase (Stemcell Technologies, #07920). Cells were then collected by centrifugation at 1200 rpm for 3 minutes and counted before seeding ...
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... Cortical layers 2/3 and 4 neurons were visualized by using an upright microscope and camera system (BX51WIF, Olympus, and SciCam Pro CCD camera ...
-
No products found
because this supplier's products are not listed.
Wenchao Li, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... SUMO 2/3 (Proteintech, cat. 11251-1-ap, 1:1000 for WB); Ubiquitin (Proteintech ...
-
No products found
because this supplier's products are not listed.
Victoria A. Trinkaus, et al.,
bioRxiv - Cell Biology 2020
Quote:
... blocking solution consisting of 2 % BSA (Roth) and 4 % donkey serum (Jackson ImmunoResearch) in PBS was added for 30 min at RT ...
-
No products found
because this supplier's products are not listed.
Dora Pinto, et al.,
bioRxiv - Immunology 2020
Quote:
... His-tagged RBD of SARS-CoV or SARS-CoV-2 was loaded for 5 minutes at 3 μg/ml in KB onto anti-Penta-HIS (HIS1K) biosensors (Molecular Devices, ForteBio). Association of mAbs was performed in KB at 15 μg/ml.