-
No products found
because this supplier's products are not listed.
Shirin Fatma, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and 2’,2’-cGAMP were purchased from Axxora. All synthetic cyclic dinucleotides were further HPLC purified ...
-
No products found
because this supplier's products are not listed.
Amalia Sintou, et al.,
bioRxiv - Immunology 2019
Quote:
... Apoptosis assays were performed using Nucleocounter NC-3000 and a Flexicyte apoptosis/necrosis detection kit based on staining with caspase 3 substrate NucView 488 and RedDot 2 (all Biotium, Cambridge Bioscience, UK). Apoptotic cells are defined as NucView488 positive and RedDot2 negative ...
-
No products found
because this supplier's products are not listed.
Nina R. Montoya, et al.,
bioRxiv - Microbiology 2022
Quote:
... The plates were developed with TMB (3, 3’, 5, 5’ - Tetramethylbenzidine) ELISA Peroxidase Substrate (Rockland Immunochemical, Limerick, PA), and absorbance was measured on a plate reader at 655 nm.
-
No products found
because this supplier's products are not listed.
Constantia Pantelidou, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... STING/TMEM173 (Novus Biologicals #NBP224683), Vinculin (CST #4650S).
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Stefan Kol, et al.,
bioRxiv - Bioengineering 2019
Quote:
... the anti-CHO HCP Detection Kit (Pall) was used according to the manufacturer’s specifications ...
-
No products found
because this supplier's products are not listed.
Mark Borris D. Aldonza, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Sandwich-based ELISA kits were used to detect PON1 (RayBiotech), FUT8 (LSBio) ...
-
No products found
because this supplier's products are not listed.
Aakash Basu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... mice were first anaesthetized with isoflurane in oxygen (3-5% during induction, slowly lowered throughout the surgery to 1-2%) while placed in a stereotaxic apparatus (Stoelting). Eyes were lubricated with ophthalmic ointment ...
-
No products found
because this supplier's products are not listed.
Thorsten M. Leucker, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PCSK9 mRNA expression was assessed by real-time PCR using PCSK9 primer sets 5’-TGTCTTTGCCCAGAGCATC-3’ and 5’-GTCACTCTGTATGCTGGTGTC-3 (Integrated DNA Technologies) and SYBR Select Master Mix (ThermoFisher, ABI 4472908).
-
No products found
because this supplier's products are not listed.
Xing Fang, et al.,
bioRxiv - Neuroscience 2022
Quote:
Cell contractile capabilities were compared using primary cerebral VSMCs (passages 2 – 4) with a collagen gel-based cell contraction assay kit (CBA-201, Cell Biolabs, San Diego, CA) following our optimized protocol 9,40,48,53,57,58 ...
-
No products found
because this supplier's products are not listed.
Manuel Carminati, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... in MRC-2 well plates (Swissci, Hampton research). The best crystals grew in 40 % (v/v ...
-
No products found
because this supplier's products are not listed.
Rebecca A. MacPherson, et al.,
bioRxiv - Genomics 2022
Quote:
... We used 2μL of the resulting DNA mixture in a PCR reaction with primers (Left: 5’-CTAGCACGGAACCCTGGAAAT -3’; Right: 5’-GCAGCGCCTAGTAATCACAGA -3’) according to ApexRedTaq (Genesee Scientific, El Cajon, CA) manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Jiannan Li, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Movies were automatically recorded by SerialEM using image shift (5×5 holes per stage position) and a K3 Direct Detection Camera (Gatan, AMETEK, Pleasanton, CA, USA) in CDS mode at a nominal magnification of 60,000× at the camera level ...
-
No products found
because this supplier's products are not listed.
Serdar Durdagi, et al.,
bioRxiv - Biophysics 2020
Quote:
For enzyme inhibition assessment Fluorescence Resonance Energy Transfer (FRET)-based cleavage assay by using 3CL Protease assay Kit (#79955-1 and #79955-2, BPS Bioscience, San Diego CA, USA) was used ...
-
3',3'-cGAMP (3',3'-cyclic GMP-AMP, Cyclic GMP-AMP, cGAMP) activates the endoplasmic reticulum...
Cat# S7905, SKU# S7905-1mg,
1mg, $390.00
Ask
Emily J. Talbot, et al.,
bioRxiv - Cell Biology 2023
Quote:
... The STING agonist diABZi (Selleck Chemicals) was used at 1 µM ...
-
No products found
because this supplier's products are not listed.
Juan Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Sulfo-Cyanine 3 Azide (2-5 uM final, Lumiprobe, #D1330), and fresh Sodium Ascorbate (100 mM final ...
-
No products found
because this supplier's products are not listed.
Ligia B. Schmitd, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mice were anesthetized with isoflurane (5% induction, 2-3% maintenance, SomnoSuite Kent Scientific) 10d after the first SNC and the crush placed immediately proximal to the first one ...
-
No products found
because this supplier's products are not listed.
Timur B. Kamalitdinov, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 5-days post-surgery along with 5-Ethynyl-2′-deoxyuridine (EdU, Click Chemistry Tools, 3 mg/kg) every day (n = 4-5/group) ...
-
No products found
because this supplier's products are not listed.
Hesam Montazeri, et al.,
bioRxiv - Genomics 2019
Quote:
... All cell lines were confirmed negative for mycoplasma infection using the PCR-based Universal Mycoplasma Detection kit (American Type Culture Collection, Manassas, VA) as previously described [42].
-
No products found
because this supplier's products are not listed.
Alvina I. Khamidullina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
No products found
because this supplier's products are not listed.
Yun Tian, et al.,
bioRxiv - Microbiology 2021
Quote:
... for PCR-based assays or a column-based RNA/DNA/protein purification kit (Norgen Biotek, Ontario, Canada) for transcriptomic analysis ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ...
-
No products found
because this supplier's products are not listed.
Hamza A. A. Elati, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2’,3’-dideoxyuridine was from Carbosynth; Pyrimethamine was from Fluka ...
-
No products found
because this supplier's products are not listed.
Gerd Ulrich Balcke, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Scheduled multiple reaction monitoring (MRM)-based metabolite detection was performed in negative mode electrospray ionization (ESI) on a QTrap6500 (AB-Sciex GmbH ...
-
No products found
because this supplier's products are not listed.
Michael Fairhead, et al.,
bioRxiv - Biochemistry 2019
Quote:
... in Swissci 3 well sitting drop plates (Molecular Dimensions). Crystals appeared in several conditions over 4-7 days ...
-
No products found
because this supplier's products are not listed.
Harold L. Haun, et al.,
bioRxiv - Neuroscience 2022
Quote:
... all mice received vehicle injections prior to drinking on Day 1 and CNO testing occurred across Day 2-5 in a crossover design such that each subject received a single dose of CNO (3 mg/kg; HelloBio, HB6419). CNO was prepared daily in saline and delivered at 0.01 ml/kg volume 30-min prior to drinking.
-
No products found
because this supplier's products are not listed.
Xian Zhou, et al.,
bioRxiv - Immunology 2022
Quote:
... Plates were washed four times and horseradish peroxidase (HRP)-conjugated detection Abs for IgG (Bethyl Laboratories) were added for 1 h at RT ...
-
No products found
because this supplier's products are not listed.
Ana Cláudia Raposo, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... 5-(hydroxymethyl)-2′-deoxycytidine-2H3 (#H946632, Toronto Research Chemicals). MS2 data for 5hmC ...
-
No products found
because this supplier's products are not listed.
Sherman Qu, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... [15N]5-2-deoxyadenosine was obtained from Cambridge Isotope Laboratories ...
-
No products found
because this supplier's products are not listed.
Danielle R. Adney, et al.,
bioRxiv - Microbiology 2022
Quote:
... fluorescent probe (5’-6FAM-TTGACAGGCAAACAGCACAAGCAG-BHQ1-3’) (Biosearch Technologies, Novato, CA, USA). The QPCR reactions were carried out at 50 °C for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Ittipat Meewan, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... The plates were then fixed with 4% PFA evaluated immunofluorescence signal for viral detection using Rabbit anti-nucleocapsid (GeneTex, cat# GTX135357) and anti-Rabbit Alexa488 as a secondary antibody ...
-
No products found
because this supplier's products are not listed.
Xingyue An, et al.,
bioRxiv - Immunology 2020
Quote:
... 2′-3’′cyclic guanosine monophosphate adenosine monophosphate (cGAMP) from Chemietek (Indianapolis, IN). 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) ...
-
No products found
because this supplier's products are not listed.
Vilma Väänänen, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Horseradish peroxidase-based detection was carried out using EnzMet General HRP Detection Kit (Nanoprobes, ref 6010-15mL). Before detection ...
-
No products found
because this supplier's products are not listed.
Md Gulam Musawwir Khan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cell survival was measured using the WST-8 (water-soluble Tetrazolium-8: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)- 5- (2,4-disulfophenyl)-2H-tetrazolium) assay kit (CCK-8; Dojindo Molecular Technologies, #CK04) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Karen. M. Marshall, et al.,
bioRxiv - Bioengineering 2023
Quote:
... the scaffolds seeded with C2C12 cells were moved to a 24 well plate and 1.5 mL of media was added (basal with 2% FCS ± 5 µg of BMP-2 (3.33 µg/mL BMP-2). Culture was continued for 4 days and ALP staining performed on the 5th day from cell seeding ...
-
No products found
because this supplier's products are not listed.
Elise Maurat, et al.,
bioRxiv - Physiology 2023
Quote:
... Detection was achieved with 2 internal photomultiplier tubes (PMT) and 2 internal hybrid detectors ...
-
No products found
because this supplier's products are not listed.
Jérémy Dufloo, et al.,
bioRxiv - Microbiology 2024
Quote:
... Correct insertion was checked by colony PCR using vector-specific primers (Forward: 5’-GAGAACCCACTGCTTACTGGC-3’; Reverse: 5’-AGGGTCAAGGAAGGCACG-3’) and the NZYTaq II 2x Green Master Mix (NZYtech). Plasmids with correct insertions were checked by Sanger (Eurofins ...
-
No products found
because this supplier's products are not listed.
Robert Egger, et al.,
bioRxiv - Neuroscience 2019
Quote:
... or a 1:1 mix of AAV9.CamKII0.4.Cre.SV40 and either AAV9.CAG.Flex.GCaMP6f.WPRE.SV40 or AAV9.CAG.Flex.GCaMP6s.WPRE.SV40 was injected using an oil-based pressure injection system (Nanoject 3, Drummond Scientific). After injections ...
-
No products found
because this supplier's products are not listed.
Jonas L. Ravn, et al.,
bioRxiv - Microbiology 2022
Quote:
... with a starting OD600= 5 were pipetted onto Delft minimal medium agar plates (2 %) containing 0.4 % beechwood glucuronoxylan (Megazyme, Ireland) or wheat arabinoxylan (Megazyme ...
-
No products found
because this supplier's products are not listed.
Antonios Apostolopoulos, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... (e-Myco VALiD Mycoplasma PCR Detection Kit, iNtRON Biotechnology).
-
No products found
because this supplier's products are not listed.
C. R. Coveney, et al.,
bioRxiv - Physiology 2021
Quote:
In situ detection of apoptosis was conducted using TACS® 2 Tdt-Fluor In Situ apoptosis kit (Trevigen, 4812-30-K), after deparaffinising sections.
-
No products found
because this supplier's products are not listed.
Lulu Huang, et al.,
bioRxiv - Immunology 2020
Quote:
Immunohistochemistry detection was performed with the SABC kit (Boster Bioscience). Intrinsic peroxidase in samples was inactivated using 3% hydrogen peroxide after antigen retrieval was performed with buffer ...
-
No products found
because this supplier's products are not listed.
Stuart A. Collins, et al.,
bioRxiv - Neuroscience 2023
Quote:
... EPSPs were evoked at 0.1 Hz in layer 5 pyramidal neurons by electrical stimulation (100-200 µA) of layer 2/3 using an extracellular stimulating electrode (FHC, ME, USA). Membrane properties in mPFC pyramidal neurons were recorded before and 25 min after the 10Hz light stimulation ...
-
No products found
because this supplier's products are not listed.
Yusuke Nishimura, et al.,
bioRxiv - Cell Biology 2021
Quote:
Akt1/2/3 inhibitor MK-2206 dihydrochloride (ApexBio, A3010), Rapamycin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Harold P. Hodgins, et al.,
bioRxiv - Genomics 2022
Quote:
... VAMP1/2/3 (104102) were purchased from Synaptic Systems. Antibody against actin (AC-15 ...
-
No products found
because this supplier's products are not listed.
Jennifer Schwarz, et al.,
bioRxiv - Biochemistry 2021
Quote:
... or with 0.5 µg/ml doxycycline for 2-3 days) were combined in a 1:1 ratio and loaded with 5 µg/ml Indo-1 (Molecular Probes, AAT Bioquest, Sunnyvale, USA) and 0.04% of pluronic F-127 (AAT Bioquest ...
-
No products found
because this supplier's products are not listed.
Nicholas M George, et al.,
bioRxiv - Neuroscience 2021
Quote:
... for 1 minute to equilibrate before microwave-based antigen retrieval in a PELCO BioWave Pro microwave (550W for 5 minutes; Ted Pella, Redding, California). Following antigen retrieval ...
-
No products found
because this supplier's products are not listed.
Ellen Tedford, et al.,
bioRxiv - Microbiology 2022
Quote:
... MethylFlash Methylated DNA 5-mC Quantification Kit (Epigentek, US) as per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Peter Radvak, et al.,
bioRxiv - Immunology 2021
Quote:
Detection of D-dimer in tissue homogenates was carried out using mouse D-Dimer ELISA Kit (MyBioSource) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Lasse Kvich, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... filled to ∼1/3 volume with 2 and 0.1 mm diameter zirconia beads (Biospec, OK, USA) on ice ...