-
No products found
because this supplier's products are not listed.
Christelle Angely, et al.,
bioRxiv - Cell Biology 2020
Quote:
MTT (3- [4,5-dimethyl-2-thiazolyl] −2,5-diphenyltetrazolium bromide, Sigma M5655) is a tetrazolium salt giving a yellow solution when diluted in the medium ...
-
No products found
because this supplier's products are not listed.
Satoshi Yamanaka, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
No products found
because this supplier's products are not listed.
Maria-Luisa del Rio, et al.,
bioRxiv - Immunology 2024
Quote:
... and 2 mg/ml 3-[4,5-dimethylthiazol-2-yl]-5-[3-carboxymethoxyphenyl]2-[4-sulfophenyl]-2H-tetrazolium (PMS, Promega) (1/20 ...
-
No products found
because this supplier's products are not listed.
Annamarie E. Allen, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cells were incubated in treatment media for the indicated period of time and then MTS reagent ((3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) purchased from Abcam, (ab197010 ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Rachid EI Fatimy, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
No products found
because this supplier's products are not listed.
Patrick C. Kerstein, et al.,
bioRxiv - Neuroscience 2020
Quote:
... (S)-1-(2-Amino-2-carboxyethyl)-3-(2-carboxy-5-phenylthiophene-3-yl-methyl)-5-methylpyrimidine-2,4-dione (ACET; 1μM; Tocris Bioscience, catalog #2728).
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
No products found
because this supplier's products are not listed.
Dougald M. Monroe, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 4 μM lipid vesicles (Avanti Polar Lipids PS:PC:PE 3:2:5), and FV (0 ...
-
No products found
because this supplier's products are not listed.
Fumiya Kozawa, et al.,
bioRxiv - Cell Biology 2024
Quote:
... MRS 2211 (2-[(2-chloro-5-nitrophenyl)azo]-5-hydroxy-6- methyl-3-[(phosphonooxy)methyl]-4-pyridinecarboxaldehyde disodium salt and MRS 2395 (2,2-dimethyl-propionic acid 3-(2-chloro-6-methylaminopurin-9- yl)-2-(2,2-dimethyl- propionyloxymethyl)-propyl ester) were obtained from Merck (Darmstadt, Germany).
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
Paul-Lennard Mendez, et al.,
bioRxiv - Genomics 2024
Quote:
... SMAD2/3 (SMAD 2/3 XP, Cell Signaling Technology 8685) or isotype control (Rabbit IgG XP ...
-
No products found
because this supplier's products are not listed.
Kentson Lam, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Then 3-(4,5-dimethyl thiazol- 2-yl)-2,5-diphenyl tetrazolium bromide (MTT) labeling reagent (Roche) was added followed by solubilization buffer 2h later ...
-
No products found
because this supplier's products are not listed.
Konstantinos Sofiadis, et al.,
bioRxiv - Genomics 2020
Quote:
... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Ashley N. Anderson, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... followed by 3 x 5 minute washes in 2 × SSC (BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Amandine Jarysta, Basile Tarchini,
bioRxiv - Developmental Biology 2021
Quote:
rabbit anti-GNAI1/2/3 (Santa Cruz; sc-262 ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Ferdinand Althammer, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
No products found
because this supplier's products are not listed.
Sunniyat Rahman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
No products found
because this supplier's products are not listed.
Yu H. Sun, et al.,
bioRxiv - Genomics 2020
Quote:
... This mixture was aliquoted in 2-3 cryovials (Corning, NY), secured on an aluminum cryocane ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Jin-Woong Heo, et al.,
bioRxiv - Physiology 2023
Quote:
... for 2□min and 3% lead citrate (EMS, 22410) for 1□min ...
-
No products found
because this supplier's products are not listed.
Yuting Wang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 2-3 months old male young (Jackson Lab #00664) or 2-3 months old GFP+ male young (Jackson Lab #006567 ...
-
No products found
because this supplier's products are not listed.
Ahmed M. Fahmy, et al.,
bioRxiv - Immunology 2023
Quote:
... 2’’3’’-cGAMP ELISA was done using the 2’’3’’-cGAMP ELISA Kit (Cayman Chemical Co.) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Eirik S. Nilssen, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and dimethyl sulfoxide (2%; DMSO; VWR Chemicals) without prior dehydration ...
-
No products found
because this supplier's products are not listed.
Kamal L Nahas, et al.,
bioRxiv - Cell Biology 2021
Quote:
3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ...
-
No products found
because this supplier's products are not listed.
Giulio Donati, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 2 ng/mL murine interleukin 3 (PeproTech, Rocky Hill, NJ, USA). Prior to experiments involving IACS-010759 ...
-
No products found
because this supplier's products are not listed.
Mark A. Rutherford, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-diaminobenzidine plus nickel (DAB; Vector Laboratories Kit; 2-5 min reaction). Sections were analyzed with an Olympus BX51 upright microscope ...
-
No products found
because this supplier's products are not listed.
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Addgene)[70] in a ratio of 5:3:2 using polyethylenimine (24765-2, Polysciences). Virus supernatant was harvested 30 h after transfection ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Gaoyang Liang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... A Luna C18(2) C8 column (3 μm, 2 mm × 50 mm, Phenomenex) was used ...
-
No products found
because this supplier's products are not listed.
Laura Micheli, et al.,
bioRxiv - Neuroscience 2021
Quote:
... PlGF-2 (3 – 30 ng; 5 µl; cat.465-PL/CF, R&D System, USA), VEGF-E (3 – 30 ng ...
-
No products found
because this supplier's products are not listed.
Sina Ibne Noor, et al.,
bioRxiv - Biochemistry 2020
Quote:
... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
No products found
because this supplier's products are not listed.
Jihae Shin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
No products found
because this supplier's products are not listed.
Andrea Tagliani, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Desalting columns (NAP-5 and PD-10) and N-[6-(Biotinamido)hexyl]-3’-(2’-pyridyldithio)proprionamide (HPDP-biotin) were purchased from GE Healthcare and Pierce ...
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004185,
Bulk, Inquire
Ask
Luke R. Perreault, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Minced tissue underwent 3-5 serial digestions in collagenase type 2 (Worthington Biochemical Corp, Lakewood, NJ) in sterile PBS with 20 mM glucose ...
-
No products found
because this supplier's products are not listed.
Sarah Hyllekvist Jørgensen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and AKT 1/2/3 (p-S473) Assay Kits (PerkinElmer). Cell lysis and SureFire Assay were performed following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Damien Detraux, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Cells were passaged every 2-3 days using accutase (Stemcell Technologies, #07920). Cells were then collected by centrifugation at 1200 rpm for 3 minutes and counted before seeding ...
-
No products found
because this supplier's products are not listed.
Qiao Wen Tan, Emmanuel Tan, Marek Mutwil,
bioRxiv - Plant Biology 2024
Quote:
... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
No products found
because this supplier's products are not listed.
Christos Georgiadis, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3% human serum (Seralab) +20 ng/ml human recombinant IL-2 (Miltenyi Biotec) and activated with TransAct reagent (Miltenyi Biotec) ...
-
No products found
because this supplier's products are not listed.
Camille Danne, et al.,
bioRxiv - Immunology 2022
Quote:
Mice were administered drinking water supplemented with 2-3% (wt/vol) DSS (MP Biomedicals) for 5-7 days (depending on colitis severity of each experiment) ...
-
No products found
because this supplier's products are not listed.
Dora Pinto, et al.,
bioRxiv - Immunology 2020
Quote:
... His-tagged RBD of SARS-CoV or SARS-CoV-2 was loaded for 5 minutes at 3 μg/ml in KB onto anti-Penta-HIS (HIS1K) biosensors (Molecular Devices, ForteBio). Association of mAbs was performed in KB at 15 μg/ml.
-
No products found
because this supplier's products are not listed.
Richard B Crouse, et al.,
bioRxiv - Neuroscience 2020
Quote:
... blocked for 2-3 hours (0.3% Triton X-100, American Bioanalytical, Canton, MA; 3% normal donkey serum, Jackson ImmunoResearch, West Grove, PA), then incubated overnight with primary antibodies (1:1000 + 1% normal donkey serum) ...
-
No products found
because this supplier's products are not listed.
Vaky Abdelsayed, et al.,
bioRxiv - Biophysics 2022
Quote:
... including 2-color and 3-color STORM was performed on an IX83 Inverted microscope (Olympus) using a 100x 1.3NA objective (Olympus) ...
-
No products found
because this supplier's products are not listed.
Jennifer S. Chen, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 3 dpi by high content imaging (BioTek Cytation 5) configured with brightfield and GFP cubes ...
-
No products found
because this supplier's products are not listed.
Yoichi Araki, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or Spinning disk confocal microscopes controlled by axiovision software (Carl Zeiss; Fig. 2, 3, and 5). Following 5-10 min of baseline recording ...
-
No products found
because this supplier's products are not listed.
Wenchao Li, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... SUMO 2/3 (Proteintech, cat. 11251-1-ap, 1:1000 for WB); Ubiquitin (Proteintech ...
-
No products found
because this supplier's products are not listed.
Katie G. Owings, Clement Y. Chow,
bioRxiv - Genetics 2023
Quote:
... 30 samples were collected (5 timepoints x 2 genotypes x 3 replicates) and RNA was extracted using a Direct-zol RNA Miniprep (Zymo Research R2061) using TRIzol Reagent (ThermoFisher Cat # 15596026 ...
-
No products found
because this supplier's products are not listed.
Anna Ruzhanskaya, et al.,
bioRxiv - Biochemistry 2020
Quote:
... One was through twice daily measurement of 2 or 3 levels of QC specimens obtained from Beckman Coulter Inc ...
-
No products found
because this supplier's products are not listed.
Juwel Chandra Baray, et al.,
bioRxiv - Immunology 2020
Quote:
... The plate was washed for 3 times then incubated with mouse sera and SARS-CoV-2 Spike antibody (Sino Biological, China) for 2 hours at 37 °C ...