-
No products found
because this supplier's products are not listed.
Thomas Bessy, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 1% of photoinitiator (2-hydroxy-2-methylpropiophenone - Sigma) was immediately introduced by capillary action between the PDMS stamp and the glass coverslip ...
-
No products found
because this supplier's products are not listed.
Uday Saxena, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
No products found
because this supplier's products are not listed.
Kate Harris, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 4-(2-Butyl-6,7-dichloro-2-cyclopentyl-indan-1-on-5-yl) oxobutyric acid (DCPIB; Tocris), superoxide dismutase (SOD ...
-
No products found
because this supplier's products are not listed.
Helen Carrasco Hope, et al.,
bioRxiv - Immunology 2020
Quote:
... T cells were cultured with 2-deoxy-2-((7-nitro-2, 1, 3-benzooxadiazol-4-yl)amino)-glucose (2-NBDG) (Abcam 50μM, 1h), 4 ...
-
No products found
because this supplier's products are not listed.
Maria-Luisa del Rio, et al.,
bioRxiv - Immunology 2024
Quote:
... and 2 mg/ml 3-[4,5-dimethylthiazol-2-yl]-5-[3-carboxymethoxyphenyl]2-[4-sulfophenyl]-2H-tetrazolium (PMS, Promega) (1/20 ...
-
No products found
because this supplier's products are not listed.
Juan Martín D’Ambrosio, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 18:1 lyso-PS (1-oleoyl-2-hydroxy-sn-glycero-3-phospho-L-serine, Avanti Polar Lipids), was dried under argon and resuspended in SD medium to 54 μM lyso-PS by vortexing and heating to 37°C ...
-
No products found
because this supplier's products are not listed.
Krzysztof Mikołajczyk,
bioRxiv - Biochemistry 2024
Quote:
... and untransfected cells were cultured for 2 weeks in a complete medium containing 3 μM N-[(1R,2R)-1- (2,3-dihydro-1,4-benzodioxin-6-yl)-1-hydroxy-3-pyrrolidin-1-ylpropan-2-yl]nonanamide (Genz-123346) (Merck, Darmstadt, Germany), a glucosylceramide synthase inhibitor [26].
-
No products found
because this supplier's products are not listed.
Roza Izgilov, et al.,
bioRxiv - Cell Biology 2023
Quote:
using a fluorescent glucose analog, 2-NBDG (2-Deoxy-2-[(7-nitro-2, 1, 3-benzoxadiazol-4-yl) amino]-D-glucose) (11046, Cayman chemical). Cultured 3T3-L1 cells “starved” in a glucose-free medium at 37°C for 1 hr ...
-
No products found
because this supplier's products are not listed.
Cintia Checa-Rodríguez, et al.,
bioRxiv - Cell Biology 2023
Quote:
MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay (Roche) was performed following manufacturer’s indications ...
-
No products found
because this supplier's products are not listed.
Žiga Avsec, et al.,
bioRxiv - Genomics 2020
Quote:
... ɑ-Pbx 1/2/3 (Santa Cruz, sc-888), and ɑ-Zic3 (Abcam ...
-
No products found
because this supplier's products are not listed.
Alexa C. Cannon, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... PAK 1/2/3 1:1000 (Cell Signaling Technology Cat# 2604, RRID:AB_2160225), Myc-Tag 1:1000 (Cell Signaling Technology Cat# 2276 ...
-
No products found
because this supplier's products are not listed.
Patrick O. Byrne, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... IgG(1/2/3)-FITC (BD Pharmingen), and IgM-PE-Cy7 (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
Wenchao Li, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... SUMO 2/3 (Proteintech, cat. 11251-1-ap, 1:1000 for WB); Ubiquitin (Proteintech ...
-
No products found
because this supplier's products are not listed.
Khem Raj Giri, et al.,
bioRxiv - Immunology 2020
Quote:
... CD81 (Eat-2; 1:1000; BioLegend), CD9 (EM-04 ...
-
No products found
because this supplier's products are not listed.
Pippa F. Cosper, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and stained with antibodies to α-tubulin (YL 1/2; 1:1000, Bio-Rad) and centromeres (HCT-0100 ...
-
No products found
because this supplier's products are not listed.
Vishal Singh, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 2) anti-fibrinogen (1/500) (Dako, A008002-2), 3 ...
-
No products found
because this supplier's products are not listed.
John P. Gillies, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 1-1/2 coverslips (Corning) sonicated in 100% ethanol for 10 min were used for the flow-chamber assembly ...
-
No products found
because this supplier's products are not listed.
Matthew P. DeJong, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 2 μL of 2 U L-1 ExoI (NEB) was added and incubated at 37 °C for 30 minutes then 80 °C for 20 minutes ...
-
No products found
because this supplier's products are not listed.
Gantsetseg Tumurkhuu, et al.,
bioRxiv - Immunology 2024
Quote:
2’-3-cyclic GMP-AMP (cGAMP) (tlrl-nacga23-1, InvivoGen) was added at 10μg/mL with or without 4μM H151 (inh-h151 ...
-
No products found
because this supplier's products are not listed.
Danielle L. Tomasello, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Vesicular Glutamate 1 and 2 (VGlut1/2, Synaptic Systems) or Postsynaptic Density 95 (PSD95 ...
-
No products found
because this supplier's products are not listed.
Gina Partipilo, et al.,
bioRxiv - Bioengineering 2024
Quote:
... disodium;4-[3-pyridin-2-yl-6-(4- sulfonatophenyl)-1,2,4-triazin-5-yl]benzenesulfonate hydrate (Ferrozine, VWR) All media components were autoclaved or sterilized using 0.2 μm PES filters.
-
No products found
because this supplier's products are not listed.
Joshua Mills, et al.,
bioRxiv - Microbiology 2023
Quote:
... with a final concentration of 2% formaldehyde and 2% NuSieve 3:1 agarose (Lonza). 5 µg RNA was denatured for 10 min at 70 °C with 1 X MOPS buffer (20 mM MOPS ...
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
No products found
because this supplier's products are not listed.
Oksana Y. Dudaryeva, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and fibroblast growth factor 2 (FGF-2, 5 ng mL-1; PeproTech). Cells were passaged before reaching 90% confluency and the medium was changed every 2–3 days.
-
No products found
because this supplier's products are not listed.
Marta E. Stremska, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 μm (#19118-2; Polysciences) or 6 μm (#17145-4 ...
-
No products found
because this supplier's products are not listed.
Senthilvelrajan Kaniyappan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... covered with either 2 nm amorphous carbon (Quantifoil, R2/1+2 nm C) or graphene were used for sample preparation ...
-
Prepared to contain higher clostripain activity. Suggested for bone, heart, liver, thyroid and...
Cat# LS004174,
100 mg, $42.00
Ask
Nancy Q. Liu, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 1 mg/mL type 2 collagenase (Worthington), 10 µg/mL gentamycin (Teknova ...
-
No products found
because this supplier's products are not listed.
He-Yun Hsiao, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... we employed the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) or WST-1 (Water-Soluble Tetrazolium 1) assay from Takara, Japan ...
-
No products found
because this supplier's products are not listed.
Karthikeyan Thirugnanam, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Smad 2/3 (Novus Biologicals, Cat# AF3797, 1:200 dilution), GAPDH (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
P Duarte-Guterman, et al.,
bioRxiv - Neuroscience 2023
Quote:
... (1:2, Rat adsorbed, Vector laboratories) diluted in TBS ...
-
No products found
because this supplier's products are not listed.
Bin Tang, et al.,
bioRxiv - Plant Biology 2021
Quote:
... zmcd1-1 and zmcd1-2 (EMS mutants), as well as the F1 hybrids (obtained by crossing the EMS mutants with test inbred lines ...
-
No products found
because this supplier's products are not listed.
Moritz Peters, et al.,
bioRxiv - Genomics 2024
Quote:
... 2 µl Proteinase K (Qiagen, RP107B-1) and 5 µl water was added to each tube with 5 µl sub-library for a final volume of 20 µl per reaction ...
-
No products found
because this supplier's products are not listed.
Alec S.T. Smith, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 2 ng/ mL IGF-1 (R&D Systems), and 10 ng/ mL HGF (R&D Systems) ...
-
No products found
because this supplier's products are not listed.
Olaf Klingbeil, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... LATS1/2 (GeneTex, GTX87014, 1:1,000), p-LATS1/2 (T1079/T1041 ...
-
No products found
because this supplier's products are not listed.
Sarah Hyllekvist Jørgensen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and AKT 1/2/3 (p-S473) Assay Kits (PerkinElmer). Cell lysis and SureFire Assay were performed following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Ayijiang Yisimayi, et al.,
bioRxiv - Immunology 2023
Quote:
ELISA assays were conducted by pre-coating ELISA plates with RBD (SARS-CoV-2 wild type, SARS-CoV-2 BA.1, SARS-CoV-2 BA.2 RBD, Sino Biological) at concentrations of 0.03 μg ml−1 and 1 μg ml−1 in PBS overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Carl-Christian Kolbe, Eicke Latz,
bioRxiv - Biochemistry 2020
Quote:
2 µg GST (GenScript; Cat. # Z02039-1), ubiquitin (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Thomas Heaven, et al.,
bioRxiv - Genomics 2024
Quote:
... Two libraries were pooled and sequenced on a NextSeq 550 using High Output Kit v2.5 (300 Cycles: 146 read 1, 18 index 1, 8 index 2, 146 read 2) (Illumina) according to the manufacturers protocol ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Katrin Linda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Medium was refreshed every 2-3 days and cells were passaged 1-2 times per week using an enzyme-free reagent (ReLeSR, Stem Cell Technologies). For autophagy induction cells were treated with 200 µM Rapamycin (ChemCruz ...
-
No products found
because this supplier's products are not listed.
Ankita Pramanick, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 1% penicillin-streptomycin and 5ng/ml Human Recombinant Fibroblast Growth factor-2 (FGF-2) (130093564, Miltenyi Biotec). Fibroblasts were passaged using trypsin EDTA 0.5% ...
-
No products found
because this supplier's products are not listed.
Shion A. Lim, et al.,
bioRxiv - Biochemistry 2021
Quote:
... F(ab’)2 fragment specific (Jackson ImmunoResearch: 1:1000). Cells were washed 3x with PBS + 3% BSA and fluorescence was quantified using a CytoFLEX (Beckman Coulter ...
-
No products found
because this supplier's products are not listed.
Sebastian N.W. Hoernstein, et al.,
bioRxiv - Plant Biology 2022
Quote:
... diluted 1:10,000 in 2% TBST with 2% Blocking (GE Healthcare), was applied for 1 h.
-
No products found
because this supplier's products are not listed.
Icaro Putinhon Caruso, et al.,
bioRxiv - Biophysics 2021
Quote:
... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
No products found
because this supplier's products are not listed.
Yuting Wang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 2-3 months old male young (Jackson Lab #00664) or 2-3 months old GFP+ male young (Jackson Lab #006567 ...
-
No products found
because this supplier's products are not listed.
Zachary Beine, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The primary antibody (2-3% serum, 0.4% PBST, 1:500 Rockland 600-401-379) was applied and incubated for ninety minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Matthew S.J. Mangan, et al.,
bioRxiv - Immunology 2021
Quote:
... Rac1/2/3 (1:1000, rabbit polyclonal #2465) from CST, actin (mouse or rabbit, both 1:1,000 dilution) from LI-COR Biosciences ...
-
No products found
because this supplier's products are not listed.
Eve T. Beauchemin, et al.,
bioRxiv - Microbiology 2022
Quote:
... the bacteria were first incubated in 3 wells of a 96-well plate for 1 hour in an Epoch 2 Microplate Spectrophotometer (BioTek), with optical density measured at 600 nm (OD600) ...
-
No products found
because this supplier's products are not listed.
Poonam Roshan, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... NFIB (1:2000 in 2% milk, Bethyl), Snail (1:1000 ...
-
No products found
because this supplier's products are not listed.
C. Lam, et al.,
bioRxiv - Microbiology 2021
Quote:
... Pool 1 and pool 2 amplicons were combined and purified with a 1:1 ratio of AMPureXP beads (Beckman Coulter) and eluted in 30 μL of sterile water ...