-
No products found
because this supplier's products are not listed.
Yan Li, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... or 1000 nM of 2-(4-amino-1-isopropyl-1H-pyrazolo[3,4-d]pyrimidin-3-yl)-1H-indol-5-ol (PP242; Sigma, P0037), (2 ...
-
No products found
because this supplier's products are not listed.
Jaakko Haverinen, Minna Hassinen, Matti Vornanen,
bioRxiv - Physiology 2021
Quote:
... L-364,373 (R-L3 or 5-(2-Fluorophenyl)-1,3-dihydro-3-(1H-indol-3-ylmethyl)-1-methyl-2H-1,4-benzodiazepin-2-one) (Tocris Cookson; Bristol, UK) and mefenamic (dimethylphenylaminobenzoic ...
-
No products found
because this supplier's products are not listed.
Blanca Salazar-Sarasua, et al.,
bioRxiv - Plant Biology 2021
Quote:
... in paraffin-embedded sections (8µm) and color was detected with 5-bromo-4-chloroindol-3-yl phosphate/nitrateblue tetrazolium (BCIP/NBT) (Roche).
-
No products found
because this supplier's products are not listed.
Nancy G. Azizian, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... were purchased from Click Chemistry Tools and Tris [(1-benzyl-1H-1, 2, 3-triazol-4-yl)methyl] amine from Fisher Scientific.
-
No products found
because this supplier's products are not listed.
Irene Julca, et al.,
bioRxiv - Plant Biology 2022
Quote:
... The medium was aspirated and fresh medium containing 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, premixed in 5:1 ratio, Promega) was added to the treated cells ...
-
No products found
because this supplier's products are not listed.
Helen Carrasco Hope, et al.,
bioRxiv - Immunology 2020
Quote:
... T cells were cultured with 2-deoxy-2-((7-nitro-2, 1, 3-benzooxadiazol-4-yl)amino)-glucose (2-NBDG) (Abcam 50μM, 1h), 4 ...
-
No products found
because this supplier's products are not listed.
Junki Uchiyama, Yasushi Ishihama, Koshi Imami,
bioRxiv - Biochemistry 2020
Quote:
... 0.625 mM TBTA (Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine) (Merck Millipore), and 6.25 mM CuSO4 (Merck Millipore) ...
-
No products found
because this supplier's products are not listed.
Justin E. Silpe, et al.,
bioRxiv - Microbiology 2021
Quote:
... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
No products found
because this supplier's products are not listed.
Anne Billet, et al.,
bioRxiv - Biochemistry 2023
Quote:
... HCTU (O-(1H-6-chlorobenzotriazole-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate) from VWR, dichloromethane (DCM) ...
-
No products found
because this supplier's products are not listed.
Anne D. Villela, et al.,
bioRxiv - Microbiology 2020
Quote:
... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
No products found
because this supplier's products are not listed.
Ganna Galitska, et al.,
bioRxiv - Microbiology 2023
Quote:
DDD85646/IMP-366(2,6-dichloro-4-[2-(1-piperazinyl)-4-pyridinyl]-N-(1,3,5-trimethyl-1H-pyrazol-4-yl)-benzenesulfonamide) was purchased from Cayman Chemicals and used as an inhibitor of viral assembly at the final concentration of 5 µM ...
-
No products found
because this supplier's products are not listed.
Benjamin C. Shaw, et al.,
bioRxiv - Molecular Biology 2022
Quote:
The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
No products found
because this supplier's products are not listed.
Hannah Elcocks, et al.,
bioRxiv - Cell Biology 2023
Quote:
... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
No products found
because this supplier's products are not listed.
Yun Deng, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... with 5-bromo-4-chloro-3-indolyl-phosphate nitro blue tetrazolium staining (Vector Laboratories, Burlingame, CA, USA). 10 ∼ 30 embryos were used for each probe ...
-
No products found
because this supplier's products are not listed.
Bradley R Corr, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 5′-bromo-2′-deoxyuridine (BrdU) (Cat. #550891; BD Biosciences; RRID:AB_2868906) was then added directly to the well culture media (final concentration 10 µM) ...
-
No products found
because this supplier's products are not listed.
Basila Moochickal Assainar, et al.,
bioRxiv - Biophysics 2023
Quote:
... 0.5% NBD-PC (1-palmitoyl-2-(6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl)-sn-glycero-3-phosphocholine (Avanti Polar Lipids, Inc.)) ...
-
No products found
because this supplier's products are not listed.
Pau Perez Escriva, Tobias Fuhrer, Uwe Sauer,
bioRxiv - Microbiology 2021
Quote:
... Online mass calibration was performed using a second spray needle and a constant flow (5 ul/min) of reference solution containing purine and hexakis (1H, 1H, 3H -tetrafluoropropoxy)phosphazine (HP-0921, Agilent Technologies). Compounds were identified based on the retention time of chemical standards and their accurate mass (tolerance 20 ppm) ...
-
No products found
because this supplier's products are not listed.
Coralie Hérent, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Cy-3 or Cy-5 (1:500, Jackson ImmunoResearch). Sections were counterstained with a fluorescent Nissl stain (NeuroTrace 435/445 blue ...
-
No products found
because this supplier's products are not listed.
Ugo Sardo, et al.,
bioRxiv - Physiology 2023
Quote:
... Membranes were blocked 1h with 5% of non-Fat dry milk (NFDM, Cell signaling) diluted in TBS-T buffer (10mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Martina Pauk, et al.,
bioRxiv - Physiology 2024
Quote:
5-Bromo-2-deoxyuridine (BrdU) assay was performed with BrdU (Santa Cruz Biotechnology) and anti-BrdU antibody (Santa Cruz Biotechnology) ...
-
No products found
because this supplier's products are not listed.
Meghan Robinson, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 0.5 mM RA and 1 mM 8-bromo-cAMP (Peprotech, 2354843) were added ...
-
No products found
because this supplier's products are not listed.
Hua Li, et al.,
bioRxiv - Cell Biology 2020
Quote:
... was amplified by PCR using the primers (5’-GGTTCCGCGTGGATCCATGTCTCATGCAGCCGAGCCA-3’ and 5’-GGAATTCCGGGGATCCTCAGGACTCCTCTTCAATGCTGA-3’) and cloned into BamHI site of pGEX-4T-1 expression vector (GE Healthcare) using In-Fusion HD Cloning System (Clontech) ...
-
No products found
because this supplier's products are not listed.
William D Jackson, et al.,
bioRxiv - Immunology 2023
Quote:
C57BL/6 mice were treated twice with topical R848 and then were injected once I.P with 2 mg of (5-bromo-2’-deoxyuridine) BrdU (Biolegend). Bone-marrow (BM ...
-
No products found
because this supplier's products are not listed.
Marco S. Kaiser, et al.,
bioRxiv - Physiology 2021
Quote:
... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
No products found
because this supplier's products are not listed.
Masahito Yamagata, Wenjun Yan, Joshua R. Sanes,
bioRxiv - Neuroscience 2020
Quote:
... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
No products found
because this supplier's products are not listed.
Ole A.W. Haabeth, et al.,
bioRxiv - Immunology 2021
Quote:
... After washing wells were incubated with a 5-bromo-4-chloro-3⍰-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) substrate (R&D systems, mouse IFNγ Kit Cat # EL485). Plates were scanned and analyzed using ImmunoSpot Microanalyzer.
-
No products found
because this supplier's products are not listed.
Katarzyna Wacnik, et al.,
bioRxiv - Microbiology 2021
Quote:
... 3 µl of 1 M NaOH and 6 µl of Cell-Tak (Corning, 5% (w/v) in acetic acid ...
-
No products found
because this supplier's products are not listed.
Wei Huang, et al.,
bioRxiv - Genetics 2023
Quote:
... 14-3-3 polyclonal antibody (Proteintech, Cat#14503-1-AP), and beta tubulin antibody (Abways Technology ...
-
No products found
because this supplier's products are not listed.
Walden Li, Ryan M. Wyllie, Paul A. Jensen,
bioRxiv - Microbiology 2020
Quote:
... Strains carrying the pLacZ plasmid appear blue when plated on 0.008% X-gal (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Zymo Research, CA, USA). X-gal concentrations above 0.008% appear to inhibit growth of S ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Buse Baran, et al.,
bioRxiv - Plant Biology 2024
Quote:
... Guide RNA sequences “5-CGUGUCACGACGGAGUGGAU-3” and “5-AUGUUGUAUGUGCCUAUACG-3” were synthesized by GenScript by adding the Cas12a scaffold sequence (5-UAAUUUCUACUCUUGUAGAU-3 ...
-
No products found
because this supplier's products are not listed.
Sepideh Mostafavi, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Post-fixation was performed for 1h (on ice) in 1% osmium tetroxide (EMS # 19134) diluted in 0,1 M sodium cacodylate buffer ...
-
No products found
because this supplier's products are not listed.
Alice L. Herneisen, et al.,
bioRxiv - Microbiology 2024
Quote:
... The membrane was incubated in secondary antibody solution (1:10,000 Goat anti-Mouse IgG IRDye 800 or 680) in 5% milk/PBS for 1h at room temperature and was visualized by LI-COR Odyssey CLx ...
-
No products found
because this supplier's products are not listed.
Vignesh Venkatakrishnan, et al.,
bioRxiv - Biochemistry 2020
Quote:
... disrupted with a tip sonicator at 1/3 power (8 MHz) for 3 × 30 seconds on ice and fractionated by ultracentrifugation (100’000 x g, 1H, Beckman TLA 120.2 rotor). The luminal fraction was concentrated to around 50 µL on a 3 kDa MWCO Amicon Ultra 0.5 mL centrifugal filter while membrane pellets were dissolved in 50 µL TBS with 2% SDS ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Gladiola Goranci-Buzhala, et al.,
bioRxiv - Cell Biology 2020
Quote:
... coated culture dishes for 1h at 37°C with 5% CO2 using mTeSR1 medium (STEMCELL technologies). Cultures were routinely tested for mycoplasma contamination using MycoAlert Kit (Lonza) ...
-
No products found
because this supplier's products are not listed.
Or-Yam Revach, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Luminescence was read every 10 min for 1h using Cytation 5 microplate reader and Gen5 software (BioTek). Relative NAD(H ...
-
No products found
because this supplier's products are not listed.
Kemin Tan, et al.,
bioRxiv - Immunology 2023
Quote:
... Co- transfection of those plasmids were performed at a density of 4-5 million cells/mL in a 1:3 ratio (weight: weight) of plasmids to PEImax at 1 mg/ml (Polysciences). Following a 4-day incubation ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
Stephen Abini-Agbomson, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Cells were incubated in blocking solution (3% BSA in TBS-Tween 0.1%) for 1h with primary antibody (anti-53BP1, Rabbit polyclonal, Bethyl #A300-272A) diluted in blocking solution overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Amy R. Rappaport, et al.,
bioRxiv - Immunology 2021
Quote:
... Membranes were blocked for 1h in 5% skim milk in TBST and then probed with an anti-S2 mouse monoclonal antibody (GeneTex) at a 1:1000 dilution for 2h-overnight ...
-
No products found
because this supplier's products are not listed.
Els F. Halff, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and incubated for 1h at RT with 1:1000 mouse anti-MAP2 (Synaptic Systems, 188-011), followed by 45-60 min incubation with the appropriate Alexa-fluorophore conjugated secondary antibodies (goat-anti-mouse Alexa405 ...
-
No products found
because this supplier's products are not listed.
Ana C. Sias, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and female (GRABDA2h, N =1; GRABDA2m, N = 3) Long Evans rats (Th-cre-littermates, N = 5; Gad-cre-, N = 2; Charles River Laboratories, N = 3) aged 7-9 weeks at the time of surgery were used to record dopamine release in the BLA across Pavlovian trace conditioning ...
-
No products found
because this supplier's products are not listed.
Oona Paavolainen, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... PFA-fixed and paraffin embedded tissue slides (5 µm) were incubated for 1h at 60°C with Bond Dewax solution (Leica Bond, AR9222) to deparaffinize tissue sections ...
-
No products found
because this supplier's products are not listed.
X. Rosa Ma, et al.,
bioRxiv - Neuroscience 2021
Quote:
... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
No products found
because this supplier's products are not listed.
Nelson García-Vázquez, et al.,
bioRxiv - Biochemistry 2024
Quote:
... LC-3 (1:5,000, Novus Biological NB100–2220), p21 (1:1,000 ...
-
No products found
because this supplier's products are not listed.
Haribaskar Ramachandran, et al.,
bioRxiv - Genomics 2021
Quote:
... cells were blocked with 3%BSA diluted in PBS for 1h at RT and then incubated with anti-CD-19-PE antibody (1:50) in 3% BSA-PBS (Miltenyi Biotec) for 1h at RT ...
-
No products found
because this supplier's products are not listed.
Aaron T. Crain, et al.,
bioRxiv - Genomics 2024
Quote:
... Membranes were blocked in 5% milk in TBS- Tween for 1h prior to incubation with α-GFP (1:1000, Rockland) or α-Set8 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Jennifer Hua, et al.,
bioRxiv - Neuroscience 2022
Quote:
... BML-P137) for 1h and 2h before reading fluorescence (ex 365, em 440) on a plate reader (Flexstation 3, Molecular Devices,). For cathepsin B activity assessment by microscopy ...