-
No products found
because this supplier's products are not listed.
Xiaofei Jiao, Ning Liu, Yiding Xu, Huanyu Qiao,
bioRxiv - Cell Biology 2021
Quote:
Perfluorononanoic acid (PFNA, 97%), 3-Isobutyl-1-methylxanthine (IBMX, ≥ 99%) and 2’,7’-dichlorofluorescin diacetate (DCFH-DA, ≥ 97%) were obtained from Sigma-Aldrich (St. Louis, MO, USA). JC-1 Mitochondrial Membrane Potential Detection Kit and MitoView™ Green were purchased from Biotium (Hayward ...
-
No products found
because this supplier's products are not listed.
Sarah Easson, et al.,
bioRxiv - Physiology 2022
Quote:
... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
No products found
because this supplier's products are not listed.
Nienke Willemsen, et al.,
bioRxiv - Pathology 2022
Quote:
... and Proteasome 20S alpha 1+2+3+5+6+7 (Abcam, ab22674). After washing with TBS-T (200 mM Tris (Merck) ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Hannah Elcocks, et al.,
bioRxiv - Cell Biology 2023
Quote:
... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
No products found
because this supplier's products are not listed.
Irene Julca, et al.,
bioRxiv - Plant Biology 2022
Quote:
... The medium was aspirated and fresh medium containing 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, premixed in 5:1 ratio, Promega) was added to the treated cells ...
-
No products found
because this supplier's products are not listed.
Qian Chen, et al.,
bioRxiv - Genomics 2020
Quote:
... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
No products found
because this supplier's products are not listed.
Biao Qiu, Olga Boudker,
bioRxiv - Biophysics 2024
Quote:
... 4 mg/ml liposomes comprising 5:5:2 (w:w) 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC, Avanti Polar Lipids), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE ...
-
No products found
because this supplier's products are not listed.
Jaakko Haverinen, Minna Hassinen, Matti Vornanen,
bioRxiv - Physiology 2021
Quote:
... L-364,373 (R-L3 or 5-(2-Fluorophenyl)-1,3-dihydro-3-(1H-indol-3-ylmethyl)-1-methyl-2H-1,4-benzodiazepin-2-one) (Tocris Cookson; Bristol, UK) and mefenamic (dimethylphenylaminobenzoic ...
-
No products found
because this supplier's products are not listed.
Neta Erez, et al.,
bioRxiv - Cell Biology 2020
Quote:
E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
No products found
because this supplier's products are not listed.
Hans-Georg Sprenger, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Golgin 97 (1:1000, Cell Signaling, rabbit, #13192) RRID ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Xinjian Yu, et al.,
bioRxiv - Genomics 2024
Quote:
... included 1.11 μM N7XX (5′-CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTCTCGTGGGCTCGG-3′) and S5XX (5′-AATGATACGGCGACCACCGAGATCTACACXXXXXXXXTCGTCGGCAGCGTC-3′) primers (384PP_AQBP) in 2× HiFi HotStart ReadyMix (Roche, KK2602, 6RES_GPSA). Dual barcode sequences in primers are denoted by “XXXXXXXX.” Unique dual barcode combinations for each well of a 384-well plate were achieved by dispensing 16 unique N7XX barcodes across each row and 24 unique S5XX barcodes across each column ...
-
No products found
because this supplier's products are not listed.
Ferdinand Althammer, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Žiga Avsec, et al.,
bioRxiv - Genomics 2020
Quote:
... ɑ-Pbx 1/2/3 (Santa Cruz, sc-888), and ɑ-Zic3 (Abcam ...
-
No products found
because this supplier's products are not listed.
Patrick O. Byrne, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... IgG(1/2/3)-FITC (BD Pharmingen), and IgM-PE-Cy7 (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Sunniyat Rahman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
No products found
because this supplier's products are not listed.
Oksana Y. Dudaryeva, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and fibroblast growth factor 2 (FGF-2, 5 ng mL-1; PeproTech). Cells were passaged before reaching 90% confluency and the medium was changed every 2–3 days.
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Addgene)[70] in a ratio of 5:3:2 using polyethylenimine (24765-2, Polysciences). Virus supernatant was harvested 30 h after transfection ...
-
No products found
because this supplier's products are not listed.
Emily C. Britt, Jing Fan,
bioRxiv - Biochemistry 2020
Quote:
... 2) N-formylmethionyl-leucyl-phenylalanine (fMLP) (Cayman Chemical, 59880-97-6) or 3 ...
-
No products found
because this supplier's products are not listed.
Muhammad Shaban, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Antigen retrieval was then performed at 97 ° for 10 min with Target Retrieval Solution (Agilent, S236784-2) on a PT Module (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Catherine F. Ruff, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-diaminobenzidine plus nickel (DAB; Vector Laboratories Kit; 2-5 min reaction). Sections were washed in 0.1M cacodylate buffer and postfixed with 1% osmium and 1.5% potassium ferrocyanide in cacodylate buffer for 1 hr at RT after sections were dehydrated in an ascending gradient of ethanol (ETOH ...
-
No products found
because this supplier's products are not listed.
Laura Micheli, et al.,
bioRxiv - Neuroscience 2021
Quote:
... PlGF-2 (3 – 30 ng; 5 µl; cat.465-PL/CF, R&D System, USA), VEGF-E (3 – 30 ng ...
-
No products found
because this supplier's products are not listed.
Gina Partipilo, et al.,
bioRxiv - Bioengineering 2024
Quote:
... disodium;4-[3-pyridin-2-yl-6-(4- sulfonatophenyl)-1,2,4-triazin-5-yl]benzenesulfonate hydrate (Ferrozine, VWR) All media components were autoclaved or sterilized using 0.2 μm PES filters.
-
No products found
because this supplier's products are not listed.
Jiachao Xu, et al.,
bioRxiv - Cell Biology 2024
Quote:
... individual cells were imaged every 1.5 or 2 s for a duration of 3 or 5 min in phenol-free DMEM/F12 (Corning) containing 5% FBS and 20 mM HEPES ...
-
No products found
because this supplier's products are not listed.
Yaxi Wang, et al.,
bioRxiv - Microbiology 2023
Quote:
... 0.5 μCi 3H-GSH ([Glycine-2-3H]-Glutathione,>97%, 50μCi, PerkinElmer), and 25 μL uptake buffer and incubated for 45 min at 37°C followed by quenching with 1 mL ice-cold uptake buffer ...
-
No products found
because this supplier's products are not listed.
Hua Li, et al.,
bioRxiv - Cell Biology 2020
Quote:
... was amplified by PCR using the primers (5’-GGTTCCGCGTGGATCCATGTCTCATGCAGCCGAGCCA-3’ and 5’-GGAATTCCGGGGATCCTCAGGACTCCTCTTCAATGCTGA-3’) and cloned into BamHI site of pGEX-4T-1 expression vector (GE Healthcare) using In-Fusion HD Cloning System (Clontech) ...
-
No products found
because this supplier's products are not listed.
Buse Baran, et al.,
bioRxiv - Plant Biology 2024
Quote:
... Guide RNA sequences “5-CGUGUCACGACGGAGUGGAU-3” and “5-AUGUUGUAUGUGCCUAUACG-3” were synthesized by GenScript by adding the Cas12a scaffold sequence (5-UAAUUUCUACUCUUGUAGAU-3 ...
-
No products found
because this supplier's products are not listed.
Maude Jans, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Fixative was removed by washing 5 x 3 min in 0.1 M cacodylate buffer and samples were incubated in 2% osmium (OsO4, EMS) in 0.1 M cacodylate buffer for 30 min at RT ...
-
No products found
because this supplier's products are not listed.
Wenchao Li, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... SUMO 2/3 (Proteintech, cat. 11251-1-ap, 1:1000 for WB); Ubiquitin (Proteintech ...
-
No products found
because this supplier's products are not listed.
Clayton E. Friedman, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 5 ng/mL FGF-2 (RnD Systems) and 1 µM CHIR99021 (Stem Cell Technologies) with daily medium exchange for 3 days ...
-
No products found
because this supplier's products are not listed.
Coralie Hérent, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Cy-3 or Cy-5 (1:500, Jackson ImmunoResearch). Sections were counterstained with a fluorescent Nissl stain (NeuroTrace 435/445 blue ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Katerina Stepankova, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and anti-VGLUT1/2 (Synaptic Systems, #1235503, 1:800, 3 days). Goat anti-host antibodies of the respective primary antibodies conjugated with Alexa Fluor 405 ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
Prepared to contain higher collagenase and caseinase activities. A dialyzed, lyophilized powder.
Cat# LS005282,
1 gm, $246.00
Ask
Luke R. Perreault, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Minced tissue underwent 3-5 serial digestions in collagenase type 2 (Worthington Biochemical Corp, Lakewood, NJ) in sterile PBS with 20 mM glucose ...
-
No products found
because this supplier's products are not listed.
Jennifer S. Chen, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 3 dpi by high content imaging (BioTek Cytation 5) configured with brightfield and GFP cubes ...
-
No products found
because this supplier's products are not listed.
Karthikeyan Thirugnanam, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Smad 2/3 (Novus Biologicals, Cat# AF3797, 1:200 dilution), GAPDH (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Valentina Gandin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... using the following two primer sequences (T7 Forward: 5’-TAATACGACTCACTATAGCGTCATC-3’; Reverse: 5’-TTGTCGCACGTTCGGTGTCG-3’) and purified with DNA Clean and Concentrator-5 Kit (Zymo Research, 11-302). dsDNA was converted to RNA with HiScribe™ T7 High Yield RNA Synthesis Kit (NEB ...
-
No products found
because this supplier's products are not listed.
Qiao Wen Tan, Emmanuel Tan, Marek Mutwil,
bioRxiv - Plant Biology 2024
Quote:
... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
No products found
because this supplier's products are not listed.
Nicolò Mangraviti, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and 5 ng/ml human FGF-2 (Miltenyi Biotec). Then ...
-
No products found
because this supplier's products are not listed.
Annelot C. M. van Esbroeck, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... After rinsing the membrane with TBS-T (3 × 5 min) and TBS (3 × 5 min) fluorescence was detected by scanning on the Odyssey CLx (LI-COR Biosciences).
-
No products found
because this supplier's products are not listed.
Eleonora Grisard, et al.,
bioRxiv - Cell Biology 2021
Quote:
... rabbit anti-human 14-3-3 1/1000 (EPR6380, GeneTex), rabbit anti-human Lamp1 1/1000 (clone EPR4204 ...
-
No products found
because this supplier's products are not listed.
Breygina Maria, et al.,
bioRxiv - Plant Biology 2020
Quote:
MP of pollen protoplasts was assessed by staining with 1 µM DiBAC4(3) for 5 min (Breygina et al. 2010) on Gallios flow cytometer (Beckman Coulter), analysis was performed with FlowJo software (TreeStar) ...
-
No products found
because this supplier's products are not listed.
Jian Zhang, et al.,
bioRxiv - Immunology 2022
Quote:
... PBMCs (1×106) were stimulated with SARS-CoV-2 spike protein (S1+S2_ECD, 5 μg/ml, Sino Biological, Beijing, China) or BSA (5 μg/ml ...
-
No products found
because this supplier's products are not listed.
Nina R. Montoya, et al.,
bioRxiv - Microbiology 2022
Quote:
... The plates were developed with TMB (3, 3’, 5, 5’ - Tetramethylbenzidine) ELISA Peroxidase Substrate (Rockland Immunochemical, Limerick, PA), and absorbance was measured on a plate reader at 655 nm.
-
No products found
because this supplier's products are not listed.
Ida Paciello, et al.,
bioRxiv - Immunology 2024
Quote:
... 3 µg ml-1 of SARS-CoV-2 subunits diluted in carbonate-bicarbonate buffer (E107, Bethyl Laboratories), were coated in 384-well plates (microplate clear ...