Labshake search
Citations for GenScript :
1 - 50 of 437 citations for Yeast Expression Cloning kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: Cloning and expression of SP_1505 was undertaken commercially (Genscript). Codon-optimized SP_1505 was cloned into pET28a with a C-terminal His-tag ...
-
bioRxiv - Neuroscience 2021Quote: ... using a GenBuilder cloning kit (GenScript). pCS2HA-NPHP1 and pCS2HA-NPHP1 Δ(49-110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a GenBuilder Cloning kit (GenScript). Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT ...
-
bioRxiv - Genomics 2023Quote: ... with CloneEZ PCR Cloning Kit (GenScript #L00339). The pLenti-GIII-EF1α-CBX3-Flag-HA ...
-
bioRxiv - Genetics 2024Quote: ... and cloning into the pJR1-41XL vector116 with the CloneEZ PCR Cloning Kit (GenScript). Plasmids were checked by PCR for correct insert size and also by Sanger sequencing (Eurofins Genomics ...
-
bioRxiv - Cell Biology 2020Quote: ... the DNA encoding for mScarlet was codon optimized for expression in yeast and chemically synthesized (GenScript, Piscataway, NJ). mScarlet was then PCR amplified and cloned as a PstI/BamHI fragment into the pCM189 plasmid ...
-
bioRxiv - Cell Biology 2024Quote: The Complementary Determining Sequence (CDS) encoding PfMFS_DT was codon-optimized for expression in yeast (GenScript Biotech, United States) (Supplementary Figure S2 ...
-
bioRxiv - Genetics 2022Quote: The pancreatic isoform of human GCK (Ensembl ENST00000403799.8) was codon optimized for yeast expression and cloned into pDONR221 (Genscript). The initial test set GCK variants were generated by Genscript ...
-
bioRxiv - Genetics 2022Quote: ... Human GKRP (Ensembl ENST00000264717.7) was codon optimized for yeast expression and cloned into pDONR221 with an N-terminal HA-tag (Genscript). For yeast expression ...
-
bioRxiv - Biochemistry 2021Quote: ... gene was codon-optimized and cloned into the p423_GAL1 yeast expression vector as an N-terminal Flag (DYKDDDDK) and C-terminal decahistidine (10X His) tagged fusion protein (GenScript) (Fig ...
-
bioRxiv - Biochemistry 2024Quote: ... gene was codon-optimized and cloned into the p423_GAL1 yeast expression vector as an N-terminal Flag (DYKDDDDK) and C-terminal deca-histidine (10X His) tagged fusion protein (GenScript) (Supplementary Fig ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence of the 11 subunits of mouse CMG were codon optimised for high-level expression in budding yeast cells and produced by DNA synthesis (GenScript Biotech). A previously described ‘yeast toolkit’ (Lee et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... or with p416-GPD-PfNF54_070015200 (hereafter referred to as p416-PfPolK, i.e., cloned with the Plasmodium PfPolK gene optimized by Genscript for expression in yeast). Yeast expression vectors were transformed into yeasts by the lithium acetate method (Gietz & Woods ...
-
bioRxiv - Biochemistry 2023Quote: ... genes flanked by BamHI and HindIII sites were codon-optimized for expression in budding yeast (Figures S1A and S1B) (GenScript; Piscataway, NJ). Codon-optimized γ1-actin (ACTG1 ...
-
bioRxiv - Cell Biology 2021Quote: ... the base mNeon-pDM304 expression plasmid for N-terminal fusions was generated by restriction enzyme cloning a codon-optimized synthesized mNeon gene (GenScript) into the extrachromosomal expression plasmid pDM304 (Veltman et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The base Scarlet I-pDM304 expression plasmid for C-terminal fusions was generated by restriction enzyme cloning a codon-optimized synthesized Scarlet I gene (GenScript) into the extrachromosomal expression plasmid pDM304 (Veltman et al. ...
-
bioRxiv - Genomics 2020Quote: Identity and function of the luxI homologue were determined via cloning and expression study using Gene Synthesis service (GenScript, USA). The target DNA sequence was first synthesised in vector pUC57 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Inserts were ligated using GenBuilder™ Cloning Kit (Genscript, Piscataway NJ, USA) into pGL3-Basic (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... glutamicum open reading frames were amplified from genomic DNA by PCR and cloned in pET-28a vector by restriction free cloning 39, while expression constructs for the other proteins (CmE2p, MtE2p, MtE2b) were provided by Genscript (Leiden, the Netherlands). In all cases ...
-
bioRxiv - Biochemistry 2020Quote: The yeast Rev1 construct was purchased from GenScript. All Rev1 proteins were expressed in BL21(DE3 ...
-
bioRxiv - Immunology 2022Quote: ... or via synthesis and cloning (Genscript). The spike variants tested are B.1.1.7 (H69del-V70del-Y144del-N501Y-A570D-D614G-P681H-T716I-S982A-D1118H) ...
-
bioRxiv - Immunology 2022Quote: ... or via synthesis and cloning (Genscript) as previously reported 18,38 ...
-
bioRxiv - Molecular Biology 2023Quote: Plasmid cloning was performed by Genscript using a modified version of pcDNA3.1(+) ...
-
bioRxiv - Biophysics 2019Quote: ... coli expression (Genscript) and further subcloned in pET28a vector using NDE1 and Xho1 sites ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli or yeast and synthesized by GenScript (Piscataway, NJ) or Twist Biosciences (San Francisco ...
-
bioRxiv - Biophysics 2022Quote: ... Cloning and mutagenesis were performed by Genscript. The yeast strains were transformed using lithium acetate [28] ...
-
bioRxiv - Molecular Biology 2023Quote: ... pLKO lentiviral vectors were obtained from Sigma (SHC001) and cloning was performed by GenScript.
-
bioRxiv - Synthetic Biology 2021Quote: ... ΔVP1 was codon-optimised for yeast and synthesised by GenScript. All other synthetic genes were manually codon-optimised for S ...
-
bioRxiv - Genetics 2021Quote: ... we stained the yeast with recombinant CoV2 RBD-His6 (Genscript) at diminishing concentrations through the rounds (5nM ...
-
bioRxiv - Cell Biology 2020Quote: ... coli expression by Genscript. For cloning S1R-APEX2 fusion gene ...
-
bioRxiv - Biophysics 2021Quote: ... coli expression by GenScript® Biotech ...
-
bioRxiv - Biochemistry 2021Quote: ... coli expression (Genscript, Inc). The protein sequence is identical to PPM1HWT-LD except for the double mutation that carries two glutamate residues in the flap domain ...
-
bioRxiv - Biochemistry 2021Quote: ... coli expression (Genscript, Inc). The cDNA was cloned into pET28a-(+)-TEV at the NdeI/BamH1 restriction sites ...
-
bioRxiv - Biochemistry 2024Quote: ... coli expression (Genscript ltd.). The gene was cloned with an inducible promoter into a pGex-6p-1 plasmid containing an N-terminus GST (glutathione transferase ...
-
bioRxiv - Biophysics 2023Quote: ... coli expression by GenScript® Biotech and subcloned in pET-22b (+ ...
-
bioRxiv - Physiology 2024Quote: ... following heterologous expression in a proprietary TurboCHO™ expression system (Genscript, Piscataway, NJ). To produce C-terminally amidated recombinant ITPa (ITP-PE) ...
-
bioRxiv - Neuroscience 2019Quote: ... The GtACR1-EYFP fragment from the p7-GtCAR1 plasmid was swapped in using CloneEZ® PCR Cloning Kit (GenScript) for the myr::GFP fragment in pJFRC177 and the sequence was verified (GenScript) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... All cloning steps were carried out by GenScript, Inc.
-
bioRxiv - Immunology 2023Quote: ... cloning and mutagenesis was performed by GenScript (USA).
-
bioRxiv - Molecular Biology 2023Quote: ... Gene synthesis and cloning was performed by GenScript. E9L was inserted into the pUCDM vector ...
-
bioRxiv - Immunology 2024Quote: ... cloning and mutagenesis were performed by GenScript (USA). Amino acids are numbered according to the canonical HxB2 subtype B reference strain.
-
bioRxiv - Biochemistry 2023Quote: ... Cloning of this construct was performed by GenScript.
-
bioRxiv - Immunology 2022Quote: ... with probabilities matching yeast codon usage (GenScript Codon Usage Frequency Table). The DNA-encoded peptide sequences were flanked by invariant sequences from the yeast construct for handles in amplification and cloning ...
-
bioRxiv - Biophysics 2021Quote: ... coli plasmid expression vectors (GenScript, N-terminal 8× His-tagged followed by a TEV cleavage site) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli plasmid expression vectors (GenScript, N-terminal 8× His-tagged followed by a TEV cleavage site) ...
-
bioRxiv - Developmental Biology 2022Quote: ... coli plasmid expression vectors (GenScript, N-terminal 8-His tag followed by a TEV cleavage site) ...
-
bioRxiv - Immunology 2023Quote: ... or lambda expression vectors (GenScript). Plasmids were prepared for transient transfection of Expi293F cells using the MidiPrep plasmid plus kit (Qiagen) ...
-
bioRxiv - Immunology 2023Quote: ... or lambda expression vectors (GenScript) and subjected to transient transfection of Expi293F cells purify immunoglobulin heavy and light chain plasmids.
-
bioRxiv - Genetics 2021Quote: ... The predicted full-length lincRNA sequences were amplified by PCR and cloned into the pJR1-41XL vector (Moreno, Durán and Ribas, 2000) using the CloneEZ® PCR Cloning Kit (GenScript). Each plasmid was checked by PCR for correct insert size ...
-
bioRxiv - Developmental Biology 2021Quote: ... The ORF was subcloned into the BamH1 site of pCS2+ (pCS2+-sobp) using the Clone EZ PCR cloning kit (GenScript). pCS2+-5’HA-sobp and pCS2+-sobp-3’HA were generated using the QuikChange lightning Site-directed mutagenesis kit (Agilent) ...