Labshake search
Citations for GenScript :
1 - 50 of 280 citations for Two Hybrid cDNA Library since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The two sets of oligo libraries were synthesized on two separate chips by GenScript. The mutant sequences of each frame were amplified with Phusion DNA polymerase (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... a hybrid probe library with 6394 probes was designed and synthesized by GenScript. Magnetic bead-based capturing ...
-
bioRxiv - Immunology 2021Quote: ... Two TAP1 gRNAs (Genscript, USA) were introduced by lentiviral transduction ...
-
bioRxiv - Cell Biology 2021Quote: ... two peptides were synthesised by GenScript. One peptide contained a phosphorylated serine (P) ...
-
bioRxiv - Bioengineering 2022Quote: ... Two GenPart fragments were synthesized from GenScript for each plasmid (OA-1053A or OA-1053B) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... These two cassettes were synthesized by Genscript Inc ...
-
bioRxiv - Cancer Biology 2019Quote: Two vectors were prepared by GenScript (Piscataway, NJ) with puromycin resistance genes and the flanking guide RNA (gRNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two Mpro gene constructs were ordered from Genscript, USA in a pET28a(+ ...
-
bioRxiv - Microbiology 2020Quote: ... Two additional fragments were de novo synthesized (Genscript) and amplified by PCR (primers are listed in Table S6) ...
-
bioRxiv - Biochemistry 2021Quote: ... A further two constructs were synthesised by GenScript as above but with point mutations leucine to alanine (in bold and underlined ...
-
bioRxiv - Immunology 2021Quote: ... Two gBlock gene fragments were synthesized by Genscript to encode the modified TCRα chain ...
-
bioRxiv - Biochemistry 2022Quote: ... random mutagenesis library was generated by error-prone PCR (~8-10 mutations per kb) from the wildtype ecDHFR cDNA template (GenScript, Piscataway, NJ). The library was cloned into a pENTR1A plasmid backbone with a C-terminal YFP HA reporter tag using Gibson Assembly (HiFi DNA Assembly Cloning Kit ...
-
bioRxiv - Bioengineering 2019Quote: ... a DNA block composed of the leader sequence of the chromosomal CRISPR2 as a promoter and two CRISPR repeats spaced by two BsaI restriction sequences in opposite orientation was synthesized from GenScript (Nanjing, China), and used as a template for PCR amplification with the primer pair of L2R-XbaI-F/L2R-EcoRI-R (Table 3) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... codon-optimized cDNAs (Genscript) were transiently transfected into HEK293 cells using Lipofectamine2000 at a density of 3×106 cells per dish (100mm).
-
bioRxiv - Biochemistry 2021Quote: ... Human EPCR cDNA (Genscript) was PCR amplified and cloned in frame with a GP64 signal peptide in a pAcGP67A transfer vector ...
-
bioRxiv - Microbiology 2020Quote: Codon-optimized cDNAs (Genscript) encoding EEHV1A gB (accession number AAN03667 ...
-
bioRxiv - Bioengineering 2022Quote: The cDNA sequences (Genscript) were used for expression in Drosophila S2 cells (Life Technologies ...
-
bioRxiv - Immunology 2023Quote: ... cDNAs (synthesized by GenScript) were cloned into the retroviral plasmid MIGR1 ...
-
bioRxiv - Microbiology 2023Quote: Two plasmids (pMT-1 and pMT-2) were constructed by Genscript® using vector pUCP22.
-
bioRxiv - Immunology 2021Quote: ... the VH and VL regions of 2H1 and 2H1-hybrid antibodies were codon-optimized using a proprietary algorithm and synthetized by GenScript and then cloned into the commercially available pFUSE vectors (InvivoGen) ...
-
bioRxiv - Immunology 2021Quote: ... Spike peptide library (GenScript) consisted of 316 peptides and was divided into 4 sub-pools spanning the S1 and S2 domains (1S1=1-86 ...
-
bioRxiv - Genomics 2023Quote: The probe library (Genscript) was amplified as described in a previously published protocol8 ...
-
bioRxiv - Plant Biology 2022Quote: ... a DNA fragment containing two expression cassettes was synthesized artificially (GenScript, China): one was for the plasma-membrane-targeted mTagBFP2-FRB and the other was for the ICR1- or ICR2-fused mCherry-FKBP12 (Fig ...
-
bioRxiv - Immunology 2020Quote: ... Two commercially available ACE2-Fc proteins obtained from Genscript (Cat.No. Z03484-1) and Acrobiosystems (Cat.No ...
-
bioRxiv - Cancer Biology 2021Quote: cDNA was synthesized by GenScript with a beta-globin intron between exon 2 and 3 of APOBEC3A and a Flag tag at C-terminus ...
-
bioRxiv - Biochemistry 2021Quote: ... The cDNA of hACE2 (Genscript) was amplified by PCR and digested by KpnI and NotI ...
-
bioRxiv - Cell Biology 2021Quote: ... CPD cDNA was from GenScript clone ID OHu10876 ...
-
bioRxiv - Immunology 2021Quote: ... and cDNAs were synthesized (Genscript) as soluble trimeric constructs as described previously 45 ...
-
bioRxiv - Zoology 2022Quote: ... AeStaufen cDNA synthesized by Genscript was cloned into pIZT/ V5-His (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... or AnfD were generated using the PolyExpress Silver package (two epitopes) from Genscript. Specificity of the antibodies was confirmed using recombinant NifD ...
-
bioRxiv - Biochemistry 2021Quote: ... leaving two extra GS residues between the tag and the M125 residue (GenScript). Wild-type and the associated LonP1 mutants were expressed in BL21 (DE3 ...
-
bioRxiv - Immunology 2023Quote: ... injection at two sites on the back with 100μg of MOG35-55 (GenScript) emulsified 1:1 in 100μl CFA (Chondrex Inc.) ...
-
bioRxiv - Microbiology 2019Quote: ... and EMC4 cDNA (GenScript; clone OHu00964) were PCR amplified using tgtggtggaattctgcagataccATGGCGAAGGTCTCAGA / CGGCCGCCACTGTGCTGGATTTACTTATCGTCGTCATCCTTGTAATCAGACTGGGTGATC and tgtggtggaattctgcagataccATGACGGCCCAGGGG / CGGCCGCCACTGTGCTGGATTTACTTATCGTCGTCATCCTTGTAATCCAAAAGCAGTCCT ...
-
bioRxiv - Cancer Biology 2021Quote: ERK5 cDNAs were purchased from GenScript® (Nanjing ...
-
bioRxiv - Neuroscience 2021Quote: ... full-length cDNA was synthesized (GenScript) and subcloned into pUAST-attB ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNA was purchased from GenScript with codon optimization for E ...
-
bioRxiv - Immunology 2021Quote: ... Transgene cDNAs were purchased from Genscript, choosing the canonical (longest ...
-
bioRxiv - Molecular Biology 2022Quote: ... The DELE1 cDNA was from GenScript. The anti-eGFP monoclonal antibody (F56-6A1.2.3 ...
-
bioRxiv - Biochemistry 2023Quote: ... all cDNAs were commercially obtained (GenScript). The human ORFs were engineered to also have 39 bp of flanking sequence on both the 5′ and 3′ends that equivalently matched the flanking sequences of the orthologous yeast ORFs ...
-
bioRxiv - Molecular Biology 2023Quote: ... GLDC cDNA sequences were synthesised (GenScript) and cloned into pAAV-ITR plasmid (containing AAV2 ITRs ...
-
bioRxiv - Bioengineering 2019Quote: ... flanked by two cysteine residues (VPM peptide, GCRDVPMSMRGGDRCG, purity 96.9%, Mw 1696.96 Da, GenScript). Cells and/or soluble molecules ...
-
bioRxiv - Systems Biology 2023Quote: ... Two constructs used for the initial multiplex CRISPRi/dCpf1 prototyping were synthesized by Genscript USA Inc (Piscataway ...
-
bioRxiv - Plant Biology 2023Quote: ... Two codon-optimized ACD6Col-0 sequences were obtained and synthesized from gBlock synthesis (GenScript) and subcloned into pcDNA3.1 myc-6xHis or mGFP5-6xHis through the HiFi assembly method (NEB) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We ordered 6 libraries from GenScript® ...
-
bioRxiv - Bioengineering 2022Quote: Oligonucleotide libraries were synthesized by GenScript as three 91,766 element pools ...
-
bioRxiv - Plant Biology 2020Quote: ... we synthesized the OsVST1 cDNA sequence (GenScript) to include attL1/L2 sites for direct gateway Recombination recombination into pGWB502-omega (Nakagawa et al. ...
-
bioRxiv - Cell Biology 2020Quote: We obtained mouse TMEM16K cDNA from Genscript (Clone ID ...
-
bioRxiv - Molecular Biology 2021Quote: ... ZC3H4 cDNA (NM_015168.2) was synthesised by Genscript in a pcDNA3.1(+)-C-eGFP vector ...
-
bioRxiv - Biochemistry 2021Quote: ... The cDNAs of GALNTs 1-20 (Genscript) were amplified by PCR and digested by BamHI and NotI (GALNT1 ...
-
bioRxiv - Cell Biology 2022Quote: ... TNIP1 cDNA was obtained from Genscript (NM_001252390), TNIP1 LIR mutation fragment was synthesized by IDT gBlocks Fragments (Integrated DNA Technologies) ...