Labshake search
Citations for GenScript :
1 - 50 of 623 citations for Thiol Fluorescent Detection Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Exploring the Role of Spatial Confinement in Immune Cell Recruitment and Regeneration of Skin WoundsbioRxiv - Bioengineering 2023Quote: ... and crosslinked at a 0.6 VS to thiol ratio with di-thiol matrix metalloproteinase sensitive peptide (GenScript) plus 10 μM AlexaFluor-647 (ThermoFisher) ...
-
bioRxiv - Genomics 2020Quote: ... was reacted with a thiol-containing adhesive peptide GRGDSPC (Genscript, RP20283) in PBS with 4 mM TEA at pH 7.4 for 1 hour ...
-
bioRxiv - Developmental Biology 2023Quote: ... was reacted with a thiol-containing adhesive peptide GRGDSPC (Genscript, RP20283) in PBS with 20 mM HEPES at pH 7.4 for 1 hour ...
-
bioRxiv - Bioengineering 2024Quote: ... with di-thiol peptide crosslinkers that were either broadly protease-degradable (KKCGGPQGIWGQGCKK, Genscript) or non-degradable (KKCGGDQGIAGFGCKK ...
-
A balance between pro-inflammatory and pro-reparative macrophages is observed in regenerative D-MAPSbioRxiv - Bioengineering 2023Quote: ... the cross-linker solution was prepared by dissolving the di-thiol matrix metalloproteinase sensitive peptide (Ac-GCRDGPQGIWGQDRCG-NH2, GenScript) in distilled water at 12 mM and reacted with 10 μM Alexa-Fluor 647-maleimide (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... The cross-linker solution was prepared by dissolving the di-thiol matrix metalloproteinase-sensitive peptide (Ac-GCRDGPQGIWGQDRCG-NH2, GenScript) GenScript ...
-
bioRxiv - Bioengineering 2019Quote: ... the cross-linker solution was prepared by dissolving the di-thiol matrix metalloproteinase (MMP) sensitive peptide (Ac-GCRDGPQGIWGQDRCG-NH2, Genscript) in distilled water at 7.8 mM and reacted with 10 μM Alexa-Fluor 647-maleimide (Life-Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... the cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (Genscript, L00847), was used as directed to detect antibodies that bind competitively to the receptor binding domain (RBD ...
-
bioRxiv - Biochemistry 2022Quote: The commercially available SARS-CoV-2 Neutralization Antibody Detection Kit (cPass, GenScript) was used to identify the presence of RBD neutralizing antibodies in the serum samples from mice immunized with r3CL-pro ...
-
Development of monoclonal antibody-based blocking ELISA for detecting SARS-CoV-2 exposure in animalsbioRxiv - Microbiology 2023Quote: ... A cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript, Piscataway, NJ) was used and the test was performed following the instructions of the manufacture ...
-
bioRxiv - Neuroscience 2021Quote: ... monomers and LPS were detected using endotoxin detection kit following the manufacturer’s protocol (GenScript ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit) ...
-
bioRxiv - Neuroscience 2021Quote: ... Detection of blot was carried out with a LumiSensorTM HRP Substrate Kit (GenScript Technology).
-
bioRxiv - Immunology 2021Quote: Competitive inhibition ELISA was performed using SARS-CoV-2 neutralization antibody detection kit (Genscript). The kit detects circulating neutralizing antibodies against SARS-CoV-2 that block the interaction between the receptor binding domains of the viral spike glycoprotein (RBD ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The His-tagged GMCSF peptide was quantified using a His Tag ELISA Detection Kit (GenScript) according to the provided protocol and 5-10 fold dilutions of frozen samples.
-
bioRxiv - Immunology 2023Quote: Neutralizing antibodies were assessed using the cPass SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript) according to manufacturer’s instructions with the following changes ...
-
bioRxiv - Immunology 2021Quote: Pseudo-neutralization assays were performed on hamster serum using the cPassTM Neutralization Antibody Detection kit (GenScript).
-
bioRxiv - Immunology 2022Quote: ... 6 and 8 were analyzed with the cPass™ SARS-CoV- 2 neutralization antibody detection kit (GenScript, Cat #L00847) to detect any antibodies that neutralize the interaction between the RBDdelta and the ACE2 receptor ...
-
bioRxiv - Microbiology 2023Quote: ... species-independent surrogate virus neutralization test (sVNT) (cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit, GenScript, the Netherlands). The test was performed as prescribed by the manufacturer using a cut-off of ≥ 30 % for positivity and < 30 % for negativity ...
-
bioRxiv - Immunology 2021Quote: ... biotinylated detection antibody (GenScript, Cat# 5E10G8-Biotin) was added at 1 µg/mL final concentration in blocking buffer and plate was incubated at room temperature for 1 hour ...
-
bioRxiv - Immunology 2021Quote: Levels of neutralizing antibodies in serum samples were determined by cPASSTM SARS-CoV-2 neutralization antibody detection kit (GenScript, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: Secondary assessment of the RBD-ACE2 interaction blocking potential of the isolated nanobodies was performed using the Genscript SARS-CoV-2 Neutralization Antibody Detection Kit (#L00847, Genscript) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Fluorescent-tagged phage proteins were synthesized into pDSW206 by Genscript and delivered as lyophilized plasmid ...
-
bioRxiv - Microbiology 2021Quote: The ability of aptamers to block the association of SARS-COV-2 RBD with ACE-2 was measured with the cPass™ SARS-CoV-2 Neutralization Antibody Detection kit (GenScript®). For comparison ...
-
bioRxiv - Microbiology 2020Quote: Detection and semi-quantitation of neutralizing antibodies was determined using SARS-CoV-2 Surrogate Virus Neutralization Test Kit (Genscript, Cat. No.: L00847). Testing of sera was performed as outlined in the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: The expression levels of his-tagged nanobodies resulting from microfermentations were quantified using the His tag ELISA detection kit (GenScript, Cat# L00436) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: Binding of the fluorescent transport substrate peptide RRY(CFluorescein)KSTEL (Genscript) to WT and mutant TmrAB was determined as a function of the change in fluorescence polarization as described in [10] ...
-
bioRxiv - Bioengineering 2019Quote: ... OmpT fluorescent peptide substrate was custom ordered from Genscript (Piscataway, NJ).
-
bioRxiv - Neuroscience 2024Quote: ... An additional plasmid encoding green fluorescent protein (GFP; pCAG-GFP; GenScript), was used to label successfully transfected cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... SdAb detection was performed using (1:20000) MonoRab™ Rabbit Anti-Camelid VHH Antibody conjugated to HRP (GenScript, Cat. # A01861-200) in MTBST 0.05% ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The fluorescent NOXA and BID peptides (95+% purity) were synthesized by GenScript and were N-terminally labeled with 5-FAM-Ahx and C-terminally modified by amidation ...
-
bioRxiv - Microbiology 2021Quote: Microtiter plates (96-well; Thermo) were coated with 1 μg/mL S-2P protein (Genscript) corresponding to the S protein of the Wuhan-Hu-1 virus ...
-
bioRxiv - Pathology 2021Quote: ... Samples were mixed by vortexing and tested using the GenScript cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript USA, Inc. Piscataway, NJ, USA) according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2022Quote: ... fumigatus-optimized fluorescent protein mNeonGreen by using vector pSR25 (synthesized by GenScript, Piscataway, NJ). Primer pairs AtrR-CoNG MH F (CCCGGTCTTCGACACCA ATGGTCCACCCCACGGTGGATTGGCTGGTGCCGGTGCTGGT ...
-
bioRxiv - Microbiology 2024Quote: ... and synthetic fragments and genes encoding the fluorescent proteins from Genscript (Supplementary Table 2).
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... with an Applied Bio-Rad CFX96 Sequence Detection system (Genscript, NanJing, China) was used in the real-time PCR procedure ...
-
bioRxiv - Immunology 2023Quote: ... Plates were coated with 500 ng/mL RBD or 1 μg/mL NP (GenScript, Piscataway, New Jersey), and heat-inactivated plasma (1:50 in blocking buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... SCOOP10 and SCOOP12 peptides were labeled with fluorescent 5-FAM at the N-termini (GenScript, China) and the final working concentration of labelled peptides was adjusted to 0.05 μM with ddH2O ...
-
bioRxiv - Immunology 2022Quote: ... 2 × 106 splenocytes from each animal were transferred in a round bottom 96 well plate (200 µl volume) and ex vivo restimulated with 1 µg/ml of the lmon_0149 peptides YSYKFIRV (GenScript) and QVFEGLYTL (made in house by solid phase synthesis ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were plated in a 6 well plate and co-transfected with 1 μg of pUC57-NASP-FKBP12F36V (by Genscript) and 2 μg of pSpCas9(BB)-2A-Puro-NASP-sgRNA_V2.0 (#62988 ...
-
bioRxiv - Microbiology 2023Quote: ... 1 × 106 splenocytes were plated into each well of a 96-well flat-bottom plate and either left untreated or treated with 1 ug/ml p56 (AGPHNDMEI) or p79 (TSINFVKI) peptides (Genscript, Piscataway, NJ) for 5 h at 37°C in the presence of Brefeldin A (BD Cytofix/Cytoperm ...
-
bioRxiv - Cell Biology 2019Quote: ... DOPE-MPB lipids were then reacted with the terminal cysteine residue of a fluorescent CtermCldn4 peptide (300 nM, 5-FAM-Ahx-CPPRTDKPYSAKYSAARSAAASNYV, GenScript) for 1 hr at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: ... a library of potential substrates flanked by 5FAM fluorescent dye and DABCYL quencher (5FAM-substrate-Lys{DABCYL}-Amide) was synthesized by Genscript or manufactured in-house using Liberty Blue peptide synthesizer (CEM) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Mpro inhibition assay was performed using the FRET-based fluorescent peptide substrate DABCYL-KTSAVLQ↓SGFRKM-E(EDANS)-NH2 (purchased from Genscript). The assay was standardized with enzyme concentration of 140 nM and 30 µM of fluorescent substrate in Mpro assay buffer containing (20 mM Tris pH 7.3 ...
-
bioRxiv - Neuroscience 2023Quote: ... SnifferOT cells were transiently transfected to express the red fluorescent genetically encoded calcium indicator R-GECO (GenScript, Piscataway, NJ, USA) with Fugene HD reagent (Promega ...
-
bioRxiv - Bioengineering 2024Quote: ... iFluor 647-conjugated anti-His-tag antibody (pilot CYpHER detection and TfR human/mouse cross-reactivity, Genscript A01802); Alexa Fluor 647-conjugated anti-Fc Fab (Surface protein and CYpHER quantitation ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... with a unique 5′fluorescent reporter dye (FAM) and 3 fluorescent quencher dye (TAMRA) were designed using mouse mitochondrial genome sequences and synthesized by Genscript (Piscataway, NJ). For absolute quantification using qPCR ...
-
bioRxiv - Immunology 2021Quote: ... Plates were coated overnight with 100 ng/well of S1 (Genscript) in coating buffer (0.015M carbonate/bicarbonate buffer ...
-
bioRxiv - Immunology 2020Quote: ... ELISA plates were coated with 200 ng/well CoV2 RBD protein (GenScript; Cat: Z03483) overnight at 4°C ...
-
bioRxiv - Immunology 2019Quote: 96-well plates were coated overnight at 4°C with mouse anti-Avi-tag antibody (Genscript) at 2 μg/ml in PBS ...
-
bioRxiv - Cell Biology 2020Quote: The endotoxin level of FHL-1 recombinant protein preparations was measured using the Toxin Sensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript, NJ, USA), according to the manufacturer’s protocol ...