Labshake search
Citations for GenScript :
1 - 21 of 21 citations for Sar1 Angiotensin II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Angiotensin II and SII (Sar1, Ile4,8]-Angiotensin II) 39 were obtained from Genscript (Piscataway, NJ) and MyBioSource (San Diego ...
-
bioRxiv - Biochemistry 2020Quote: ... Non-fluorogenic bradykinin(BK, RPPGFSPFR), des-Arg9-bradykinin (desBK, RPPGFSPF) and angiotensin II (Ang II, DRVYIHPF) peptides were purchased from Genscript, Inc ...
-
bioRxiv - Immunology 2023Quote: ... 50 μl of phycoerythrin (PE)– conjugated human angiotensin-converting enzyme 2 (ACE2) (hACE2; 1 μg per milliliter; GenScript) was added to the well and incubated for 30 minutes at 37°C with agitation ...
-
bioRxiv - Microbiology 2021Quote: ... of SARS-CoV-2 spike protein to Angiotensin Converting Enzyme (ACE2) was assessed via the Surrogate Virus Neutralization Test (GenScript# L00847) using the included kit protocol modified per the following ...
-
bioRxiv - Immunology 2021Quote: Antibodies inhibiting virus binding to host cell was measured using a commercial RBD-human angiotensin-converting enzyme 2 (hACE2) binding inhibition assay called cPASS™ (GenScript). As per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... of SARS-CoV-2 spike protein to Angiotensin Converting Enzyme (ACE2) was assessed via the Surrogate Virus Neutralization Test (GenScript# L00847) using the included kit protocol modified per the following ...
-
bioRxiv - Biochemistry 2020Quote: ... of SARS-CoV-2 and the ectodomain of human angiotensin converting enzyme 2 (ACE2; residue 1-615) were synthesized by GenScript (Piscataway, NJ). The S gene was fused with a C-terminal twin Strep tag [(GGGGS)2WSHPQFEK(GGGGS)2WSHPQFEK)] and cloned into a mammalian cell expression vector pCMV-IRES-puro (Codex BioSolutions ...
-
bioRxiv - Biochemistry 2020Quote: ... of SARS-CoV-2 (D614) and the ectodomain of human angiotensin converting enzyme 2 (ACE2; residue 1-615) were synthesized by GenScript (Piscataway, NJ). The S gene was fused with a C-terminal twin Strep tag [(GGGGS)2WSHPQFEK(GGGGS)2WSHPQFEK)] and cloned into a mammalian cell expression vector pCMV-IRES-puro (Codex BioSolutions ...
-
bioRxiv - Cell Biology 2019Quote: ... His6-Ii p33 wt and His6-Ii Δ27 in pCGFP-EU were purchased from GenScript. pCGFP-EU empty vector has been described before (Kawate and Gouaux 2006) ...
-
bioRxiv - Immunology 2019Quote: ... MHC class II OVA peptide (OVA323-339: ISQAVHAAHAEINEAGR) was from GenScript; HDM was from Greer ...
-
bioRxiv - Immunology 2022Quote: ... or 2 µg/ml ISQAVHAAHAEINEAGR MHC-II binding peptide (ovalbumin 323-339, GenScript) was added ...
-
bioRxiv - Cell Biology 2021Quote: FUS-CHOP type I and type II genes were synthesized by Genscript (Piscataway, NJ) and subcloned into pcDNA3-EGFP (Addgene 13031 ...
-
bioRxiv - Immunology 2021Quote: ... Antigen experienced CD4+ T cells were generated in vitro by priming lymph nodes and splenocytes of CD45.1 Marilyn mice or Thy1.1 OT-II mice with respectively 10nM Dby (NAGFN-SNRANSSRSS, Genscript) and 5μM OVAII peptide (InvivoGen) ...
-
bioRxiv - Plant Biology 2020Quote: ... The resulting products were cloned into pBluescript II KS (+) vector (Stratagene, La Jolla, CA, USA and GenScript Biotech, Netherlands). Linearized clones by HindIII or NotI were used as templates to generate antisense (HindIII ...
-
bioRxiv - Biophysics 2022Quote: ... Uniprot P13806-1), and rabbit CaVβ3 (477 residues, Uniprot P54286) followed by a Strep-tag II sequence68 were synthesized (GenScript) and each subcloned into a modified pFastBac expression vector having the polyhedrin promoter replaced by a mammalian cell active CMV promoter69 ...
-
bioRxiv - Molecular Biology 2023Quote: ... acidic coil motif (AQCEKELQALEKENAQLEWELQALEKELAQ) and Strep-Tag II (WSHPQFEK*) inserted into a pcDNA3.1-Hygro(-)-like backbone was synthesized commercially (GenScript). The R177G/R178G ...
-
bioRxiv - Synthetic Biology 2021Quote: All gBlocks fragment containing 5 sgRNA expression cassettes with high fidelity four-base overhang pair2 after cutting with type IIS restriction enzyme BbsI restriction enzyme were designed and directly sent to be synthesized into PUC57 cloning plasmid by GenScript. Two oligos with BbsI cutting sites were annealed and cloned into backbone vector with CMV promoter drive fluorescent protein expression using SpeI-HF ...
-
bioRxiv - Biochemistry 2022Quote: ... a plasmid containing 400 bp upstream of the VPH1 open reading frame followed by the SPVD chimera and 400 bp corresponding to Vph1CT amino acids 406-539 cloned into pBluescript II KS(-) vector using BamHI and XhoI was purchased from Genscript. After restriction digestion with BamH1 and Xho1 ...
-
bioRxiv - Microbiology 2022Quote: ... This codon-optimized version of dcas9 (Bbdcas9) was synthesized and cloned in pBluescript II KS (+) with flanking 5’ NdeI and 3’ NotI restriction endonuclease sites (GenScript), yielding pBS-Bbdcas9 ...
-
bioRxiv - Genetics 2023Quote: All assembly parts (consisting of fragments F1 to F12 designed in the previous protocol with appended Type IIS cut sites) were ordered as plasmids in a pUC57-mini BsaI-Free backbone from Genscript at a maxiprep scale (Supplementary Table 2) ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...