Labshake search
Citations for GenScript :
1 - 50 of 105 citations for Rubella Virus Nucleoprotein strain F Therien since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... An hMPV F B2 (strain TN99-419) version of this construct was synthesized by GenScript. Protein expression was carried out using FreeStyle 293F cells (ThermoFisher ...
-
bioRxiv - Microbiology 2022Quote: ... in-house custom rabbit anti-RVFV nucleoprotein polyclonal antibody (Genscript) and anti-pan cytokeratin typeI/II anti-cytokeratin polyclonal antibody (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... Specific anti-SCV2 immunoreactivity was detected using a SCV2 nucleoprotein antibody (Genscript) at a 1:1000 dilution ...
-
bioRxiv - Immunology 2023Quote: ... Specific anti-SCV2 immunoreactivity was detected using a SCV2 nucleoprotein antibody (Genscript) at a 1:1000 dilution ...
-
bioRxiv - Immunology 2021Quote: ... Specific anti-CoV immunoreactivity was detected using a SARS-CoV-2 nucleoprotein antibody (Genscript) at a 1:1000 dilution ...
-
bioRxiv - Evolutionary Biology 2024Quote: The gene sequences of the Vibrio astriarenae strain (HN897) strain were synthesized by Genscript, named Vsp6 ...
-
bioRxiv - Microbiology 2021Quote: Plasmids encoding cDNA for hMPV 130-BV F and hMPV B2 F proteins were synthesized (GenScript) and cloned into the pcDNA3.1+ vector as previously described (29 ...
-
bioRxiv - Microbiology 2022Quote: ... Fifteen-mer overlapping peptides from SARS-CoV-2 spike glycoprotein (Cat# PM-WCPV-S-1, JPT peptides, Berlin, Germany) and MeV-nucleoprotein (Genscript, NJ, USA) were used to stimulate splenocytes at 5 µg/mL ...
-
bioRxiv - Molecular Biology 2021Quote: The surrogate virus neutralization test (sVNT) assay was performed using the SARS-CoV-2 surrogate virus neutralization test kit (GenScript, NJ, USA). Briefly ...
-
bioRxiv - Immunology 2023Quote: The SARS-CoV-2 surrogate virus neutralization test (GenScript) was used to detect neutralizing antibodies targeting the viral spike (S ...
-
bioRxiv - Cancer Biology 2022Quote: ... plenti CRISPR v2 virus against sgRNA targeting c-MYC (Genscript) and plenti CRISPR v2 virus (control ...
-
bioRxiv - Cell Biology 2023Quote: ... and the primers covering SNPs in the Cth (F- GAGCCTGGGAGGATATGAGA, R- AAGCTCGATCCAGGTCTTCA) and Ttc4 (F – GACAGGGCGGAACTATACCA, genes. qPCR products were Sanger sequenced using the GenScript Biotec Sanger sequencing service.
-
bioRxiv - Immunology 2022Quote: ... with virus from LVX-PD1-mNeonGreen lentiviral vector (synthesized by GenScript) and cultured in RPMI1640 supplemented with 10% fetal bovine serum ...
-
bioRxiv - Immunology 2022Quote: ... with virus from pLVX-PDL1-mScarlet lentiviral vector (synthesized by GenScript) and cultured in F12 supplemented with 10% fetal bovine serum ...
-
bioRxiv - Biochemistry 2020Quote: ... Xanthoxycyclin D and xanthoxycyclin F were purchased from GenScript Inc ...
-
bioRxiv - Immunology 2023Quote: The SARS-CoV-2 Surrogate Virus Neutralization Test Kit (GenScript, L00847-A) was used according to the manufacturer’s instructions as follows ...
-
bioRxiv - Immunology 2022Quote: ... and 1 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using polyethylenimine (PEI ...
-
bioRxiv - Microbiology 2019Quote: ... and 1 µg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... which was performed using the SARS2 surrogate virus neutralization test (Genscript, Piscataway, NJ). Thirteen days after the boost ...
-
bioRxiv - Microbiology 2021Quote: The SARS-CoV-2 Surrogate Virus Neutralization Test Kit from GenScript (REF: L00847) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... and 1 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... Both plasmid cloning and BacMam virus generation were done by GenScript (Nanjing, China).
-
bioRxiv - Evolutionary Biology 2022Quote: ... All plasmids and strain construction were confirmed by Sanger sequencing (Genscript).
-
bioRxiv - Microbiology 2022Quote: ... was synthesized based on MARV strain Musoke (GenBank: DQ217792) by GenScript Biotech ...
-
bioRxiv - Immunology 2021Quote: ... All Neutralization assays were performed with the surrogate virus neutralization test (sVNT) (GenScript, USA), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: The SARS-CoV-2 surrogate virus neutralization test (sVNT) kit was obtained from GenScript Inc ...
-
bioRxiv - Microbiology 2023Quote: ... The gene coding Tobacco Etch Virus (TEV) protease was synthesized (Genscript Biotech B.V., Netherlands), then amplified by PCR using primers P1177 and P1178 and cloned into the EcoRV linearized pHYX137 by IVA in E ...
-
bioRxiv - Biochemistry 2023Quote: ... coli strain BL21 (DE3) cells and purified by Ni-NTA chromatography (GenScript).
-
bioRxiv - Immunology 2023Quote: ... coli (strain K12) TolC gene (Uniprot P02930) was synthesized by GenScript (USA) and inserted into a pET30a vector ...
-
bioRxiv - Microbiology 2021Quote: The CH0848 T/F envelope (env) sequence was chemically synthesized (GenScript, USA) and cloned into the pcDNA3.3-TOPO vector (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: HCoV-19 S gene (virus isolate: Wuhan Hu-1; GenBank number QHD43416.1) was synthesized (Genscript) with codons optimized for insect cell expression ...
-
bioRxiv - Immunology 2021Quote: Neutralizing antibodies were measured using a SARS-CoV-2 Surrogate Virus Neutralization Test Kit (Genscript). Hamster sera was diluted from 1:20 to 1:500 incubated at a 1:1 ratio with HRP conjugated SARS-CoV-2 RBD protein for 30 min at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... strains were arrested in G1 with 100 ng ml-1 alpha factor (GenScript) and incubation was continued for 3 hours ...
-
bioRxiv - Immunology 2021Quote: ... and non-human private were determined by the virus surrogate neutralization kit (cat # L00847, Genscript, Singapore). The percent of neutralizing virus in sera were determinded according to the manufacturer’s protocol
-
bioRxiv - Microbiology 2021Quote: ... using primary antibodies specific for MeV F HRC (rabbit polyclonal, Genscript, 503028-1) and 6xHis tag (rabbit polyclonal ...
-
bioRxiv - Microbiology 2021Quote: ... using primary antibodies specific for MeV F HRC (rabbit polyclonal, Genscript, 503028-1) and 6xHis tag (rabbit polyclonal ...
-
bioRxiv - Biochemistry 2023Quote: Codon optimized LayV F and G open reading frames were synthesized by Genscript and subcloned into a mammalian promoter modified expression vector pcDNA3.1-CMV77 ...
-
bioRxiv - Microbiology 2020Quote: A codon optimized MV-H gene (Edmonston B strain) was gene synthesized by GenScript. PCR amplification of the coding region of MV-H from the plasmid was performed using primers coMV-H61 N HA FWD (5’-TCGTGGTGCCAGATCTCACAGAGCCGCCATCTAT - 3’ ...
-
bioRxiv - Immunology 2020Quote: Plasmids encoding cDNAs for hMPV F proteins listed in Table S1 were synthesized (GenScript) and cloned into the pcDNA3.1+ vector ...
-
bioRxiv - Microbiology 2022Quote: The sequence of MBaMV RBP and F open reading frame were synthesized by GenScript. These were cloned into pCAGGS vector cut by EcoRI and NheI-HF with adding HA tag (RBP gene ...
-
bioRxiv - Microbiology 2021Quote: ... haemolyticus strain PK-01 chromosome (NCBI Accession: CP035541 Region: 2,573,055-2,573,114) and synthesized by GenScript Biotech Co ...
-
bioRxiv - Immunology 2022Quote: ... each T150 flasks was transfected with 2.5 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) and 6.25 μg of pLAIΔEnv GFP or 2.5 μg packaging plasmid (p8.91 ...
-
bioRxiv - Microbiology 2020Quote: ... each T150 flask was transfected with 2.5 μg of vesicular stomatitis virus-G glycoprotein encoding plasmid (pMDG) (Genscript), 2.5 μg of packaging plasmid ...
-
bioRxiv - Immunology 2021Quote: ... All neutralization assays performed with the surrogate Virus Neutralization Test (sVNT) (cat. n° L00847, GenScript, Piscataway, NJ, USA) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... a commercial competitive ELISA SARS-CoV-2 Surrogate Virus Neutralization Test (sVNT) was used (Genscript, New Jersey, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: Neutralizing antibodies were routinely detected based on the SARS-CoV-2 Surrogate Virus Neutralization Test (sVNT) kit (GenScript). This ELISA-based kit detects antibodies that hinder the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Cell Biology 2021Quote: ... fap42 and fap246 strains were separated on a 4–12% gradient SDS-polyacrylamide gel (Genscript Biotech). After the dye front migrated on the gel for 3.0–3.5 cm ...
-
bioRxiv - Molecular Biology 2021Quote: VLPs were produced by transfecting T150 flasks of HEK293T cells with 8μg of vesicular stomatitis virus-G glycoprotein (VSV-G) expressing plasmid pMDG (Genscript) pMDG ...
-
bioRxiv - Microbiology 2019Quote: ... For HIV-1 GFP/Luc each flask was transfected with 2.5 µg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) and 6.25 µg pLAIΔEnv GFP/Luc ...