Labshake search
Citations for GenScript :
1 - 50 of 1510 citations for Rat Macrophage expressed gene 1 protein MPEG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: Codon-optimised SpyCEP gene constructs were expressed in Escherichia coli using synthetic gene sequences (GenScript) from Spy_0416 in the SF370 S ...
-
bioRxiv - Molecular Biology 2023Quote: ... were expressed in the pMA vector (pMA-SthCas6-4xcrRNA-N-gene, GenScript). Cas10 gene with 15HD>HA and 573GGDD>GGAA mutations was synthesized and cloned in pACYCDuet1-SthCas10-SthCsm2 plasmid using NcoI and NotI restriction sites ...
-
bioRxiv - Synthetic Biology 2023Quote: ... W values for highly expressed genes were originally downloaded online from GenScript, and were cross referenced to published values (48) ...
-
bioRxiv - Bioengineering 2021Quote: RBD protein expressed with AviTag was purchased from GenScript. Site-specific biotinylation of the AviTag was performed using BirA Biotin-Protein Ligase Reaction kit (Avidity) ...
-
bioRxiv - Bioengineering 2021Quote: RBD protein expressed with AviTag was purchased from GenScript. Site-specific biotinylation of the AviTag was performed using BirA Biotin-Protein Ligase Reaction kit (Avidity) ...
-
bioRxiv - Immunology 2021Quote: ... chimeric group 1 or group 2 stalk proteins expressed in Sf9 cells were column purified (GenScript). For functional assays and luminex Fc receptor binding and titer ...
-
bioRxiv - Microbiology 2022Quote: The majority of the phage genes expressed in this study were synthesized and cloned by Genscript Corp ...
-
bioRxiv - Immunology 2023Quote: ... the commercialized ELISA kit (Genscript, Cat#L00871) was used ...
-
bioRxiv - Synthetic Biology 2023Quote: Synthetic genes encoding designed proteins were purchased from Genscript or Integrated DNA technologies (IDT ...
-
bioRxiv - Biophysics 2022Quote: Genes encoding all NS1 EDs and p85β proteins were prepared by gene-synthesis service from Genscript: 1918 NS1 (residues 80 to 205) ...
-
bioRxiv - Cell Biology 2020Quote: Our RAD-51 antibody was generated from a His-tagged fusion protein expressed by Genscript from plasmid pET30a containing the entire RAD-51S coding sequence (1385 bp ...
-
bioRxiv - Biochemistry 2023Quote: ... smegmatis gene MSMEG_3935 encoding RafH protein was commercially synthesized from GenScript and cloned in the pET-28a(+ ...
-
bioRxiv - Immunology 2020Quote: ... ELISA plates were coated with 200 ng/well CoV2 RBD protein (GenScript; Cat: Z03483) overnight at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... and expressed in Saccharomyces cerevisiae (GenScript) strain W303.1B (hOGC and bGIC-2 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... This 338aa protein fragment was then expressed in E.coli and used to immunize two rabbits for antibody production by GenScript. ELISA titer > 1:128,000 and target protein fragment binding validation by western blot and cell line overexpression.
-
bioRxiv - Evolutionary Biology 2020Quote: ... rosetta synaptobrevin a codon-optimised nucleotide sequence encoding the soluble portion of the protein [Syb (1-75)] was prepared by gene synthesis (Genscript, USA): GAGGCGAACCGTACCGGTGACTACCGTCTGCAGGAAGCGCAGCGTCAAGTGGGCGAAGTT CAAAACGTGATGCGTGATAACCTGACCAAGGTTATCGAGCGTGGTGAAAAACTGGACGATC TGGACGCGAAGGCGGAAGATCTGGAGGCGGAGGGTCAGCGTTTCCAAAACCGTGCGGGCC GTCTGCGTCGTCAGATGTGGTGGCAAAACAAACGTAACCAGTAA
-
bioRxiv - Cell Biology 2022Quote: ... rat-anti-Sasshort (1:50, GenScript USA Inc.); mAb Cq4 against crumbs (1:100 ...
-
bioRxiv - Biochemistry 2024Quote: Sf9 expressed GLA: We purchased from Genscript the codon-optimized wild-type and D170A mutant human GLA (UniProt P06280 ...
-
bioRxiv - Bioengineering 2022Quote: We obtained the genes encoding the designed proteins in pET28a vectors from GenScript (Genscript.com). We confirmed the sequences of all the constructs by DNA sequencing (Eton bioscience ...
-
bioRxiv - Microbiology 2021Quote: ... gene segment containing spike protein of SARS-CoV-2 wa s synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2024Quote: ... and synthetic fragments and genes encoding the fluorescent proteins from Genscript (Supplementary Table 2).
-
Integrated requirement of non-specific and sequence-specific DNA binding in MYC-driven transcriptionbioRxiv - Molecular Biology 2020Quote: ... were expressed in the pET-3a plasmid (Genscript) and purified from the BL21 (DE3 ...
-
bioRxiv - Immunology 2019Quote: Recombinant antibodies were cloned and expressed by Genscript. Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... The SECphi4 56aa protein of unknown function was the only gene not synthesized by Genscript Corp ...
-
bioRxiv - Biochemistry 2021Quote: ... The cDNAs were then cloned into pET-15b such that the expressed proteins would contain an N-terminal His-Tag (GenScript, Piscataway, NJ). Transformation of competent DH5α E ...
-
bioRxiv - Immunology 2020Quote: Templates for the expression of proteins UF1 to UF6 were prepared by gene synthesis (GenScript, USA). Before synthesis ...
-
bioRxiv - Microbiology 2023Quote: ... were generated via gene synthesis and cloned to produce 6xHis-tagged proteins by Genscript (Piscataway, NJ). Briefly ...
-
bioRxiv - Immunology 2021Quote: Competitive inhibition ELISA was performed using SARS-CoV-2 neutralization antibody detection kit (Genscript). The kit detects circulating neutralizing antibodies against SARS-CoV-2 that block the interaction between the receptor binding domains of the viral spike glycoprotein (RBD ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: The gene encoding human CDK2 (1-298) was custom-synthesized (GenScript), subcloned into pGEX6P1 vector providing an N-terminal GST-tag and expressed in E ...
-
bioRxiv - Microbiology 2020Quote: ... the gene encoding the YpCntL protein was cloned in a pET-TEV plasmid (synthetic DNA from GenScript). After transformation ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The His-tagged GMCSF peptide was quantified using a His Tag ELISA Detection Kit (GenScript) according to the provided protocol and 5-10 fold dilutions of frozen samples.
-
bioRxiv - Biophysics 2021Quote: ... the gene (Genscript) was cloned into a bacterial expression vector with N-terminal His6 and mCherry tags ...
-
bioRxiv - Microbiology 2019Quote: ... Gene synthesis (GenScript) was used to generate a C-terminal triple FLAG-tagged variant (DYKDHDGDYKDHDIDYKDDDDK ...
-
bioRxiv - Biochemistry 2023Quote: ... Gene synthesis (GenScript) and ligation-free overlap cloning(56 ...
-
bioRxiv - Molecular Biology 2023Quote: ... gene fragments (GenScript) encoding the transposase (TnpA ...
-
bioRxiv - Molecular Biology 2023Quote: ... gene fragments (Genscript) of ωRNA encoded downstream of T7 promoter ...
-
bioRxiv - Biochemistry 2024Quote: ... coli expressed saposins: We purchased from Genscript (Piscataway, NJ, USA) the codon-optimized SapB and SapD (UniProt P07602 ...
-
bioRxiv - Molecular Biology 2021Quote: The codon optimized genes encoding Argonaute proteins were ordered in pET29a expression vectors from GenScript (Piscataway, NJ, USA). Analytical amounts of twenty Argonaute proteins were synthesized from pET29a plasmids using PURExpress In Vitro Protein Synthesis kit (New England Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: The E2-Crimson-human HSD11B1 gene (variant 1) was synthesised by GenScript in vector pUC57 ...
-
bioRxiv - Biochemistry 2023Quote: ... gene blocks containing A5 fused with alternative purification tags (Genscript; Table 1) were inserted via standard cloning techniques and digested with NcoI and NotI (NEB ...
-
bioRxiv - Immunology 2022Quote: ... The purified protein was used to immunize Wistar rats to generate a panel of monoclonal antibodies by Genscript USA ...
-
bioRxiv - Biophysics 2020Quote: ... and TIN2S (HA-TIN2S, 1-354 aa) were expressed in the Sf-900 insect cells using the pFastBac1 expression system (GenScript). HA-TIN2L and HA-TIN2S were purified using anti-HA resin and stored in a buffer containing 50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Biochemistry 2020Quote: ... immunized animal sera were tested by indirect ELISA and competitive ELISA for immune response by GenScript. Western Blot evaluation of pre-sera and sera after 3rd immunization against 200 ng of purified protein/lane using a 1:1000 dilution was performed in-house as described ...
-
bioRxiv - Biochemistry 2019Quote: To obtain a plasmid that codes for full length bactofilin protein from Phytophthora infestans (PiBac), the gene PITG_07992 (UniProtKB, D0N980) was synthesised (GenScript), amplified and cloned into the pHis17 plasmid using Gibson Assembly (New England Biolabs) ...
-
bioRxiv - Biochemistry 2022Quote: ... and SARS-CoV-2 Omicron Strain S gene Human codon_pcDNA3.1(+) expressing the spike protein of the Omicron variant (GenScript# MC_0101274) were used as indicated.
-
bioRxiv - Cell Biology 2020Quote: ... was gene synthesized (GenScript). Cilia-AMSH was generated by fusing the catalytic domain of mouse AMSH (gift from David Komander ...
-
bioRxiv - Biophysics 2022Quote: ... and gene synthesized (GenScript) in pET28b+ plasmid ...
-
bioRxiv - Biochemistry 2023Quote: A synthetic gene (Genscript) encoding for ADAH11 was inserted into plasmid pHEN6 58 resulting in construct pHEN6-ADAH11 comprising a PelB secretion signal at the N-terminus and a hexa-histidine and triple-FLAG tag on the C-terminus ...
-
bioRxiv - Biochemistry 2021Quote: ... a SARS-CoV-2 S gene encoding residues 1-1138 (WuhanHu-1; GenBank: MN908947.3) was ordered (Genscript) and cloned into a pPPI4 plasmid containing a T4 trimerization domain followed by a hexahistidine tag by PstI-BamHI digestion and ligation ...
-
bioRxiv - Immunology 2021Quote: RBD and NP end-point titers were determined using standard ELISA and plates coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) or 1ug/mL SARS-CoV-2 nucleocapsid protein (NP) ...