Labshake search
Citations for GenScript :
1 - 50 of 244 citations for Rat Insulin Like 3 INSL3 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... ZmGl2-like sequence was initially obtained from GenScript as a pUC57-clone and was sub-cloned into pENTRTM/D-TOPO® entry vector (Invitrogen) ...
-
bioRxiv - Biochemistry 2021Quote: ... SMT (SUMO-like tag) fusion protein in a pET28a vector (Genscript). Quick Change mutagenesis was performed to generate the W611A mutant of hP13 ZnF5-WWE1-WWE2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Arylphorin subunit alpha-like (Demetra) and hexamerin (Ceres) were produced by Genscript, utilizing the baculovirus expression system in insect cells ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the mutated uricase-like coding sequence was synthesized by Genscript (USA Inc.) into a pET28 expression vector ...
-
bioRxiv - Physiology 2021Quote: The sequence encoding mouse like-acetylglucosaminyltransferase-1 (Large1) was synthesized (Genscript, Piscataway, NJ) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Biophysics 2021Quote: ... Purified EGF-like domain of NRG1β was incubated with G1 Flag Resin (Genscript) for 1 hr at 4 °C and serially washed 3x with Buffer A (50 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Biochemistry 2022Quote: The sequence encoding mouse like-acetylglucosaminyltransferase-1 (Large1) was synthesized (Genscript, Piscataway, NJ) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse like-acetylglucosaminyltransferase-1 (Large1) was synthesized (Genscript, Piscataway, NJ) and cloned into the AAV backbone under the transcriptional control of the muscle-specific MCK promoter (gift from Jeff Chamberlain) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the uricase-like coding sequence (XM_015290876.2) of LOC101747367 was synthesized by Genscript (USA Inc.) into pcDNA3.1+/ C-(K)DYK standard vector ...
-
bioRxiv - Molecular Biology 2023Quote: ... basic coil motif (AQCKKKLQALKKKNAQLKWKLQALKKKLAQ) and 6xHIS tag inserted into a pcDNA3.1-Hygro(-)-like backbone was synthesized commercially (GenScript). The region encoding the α4 ectodomain (M1-Q970 ...
-
bioRxiv - Molecular Biology 2023Quote: ... acidic coil motif (AQCEKELQALEKENAQLEWELQALEKELAQ) and Strep-Tag II (WSHPQFEK*) inserted into a pcDNA3.1-Hygro(-)-like backbone was synthesized commercially (GenScript). The R177G/R178G ...
-
bioRxiv - Developmental Biology 2021Quote: ... or the truncated version of Npnt containing only the N-terminal EGF-like repeats domain (Npnt-EGF) were commercially synthesized (Genscript) and cloned into the modified RCAS vector ...
-
bioRxiv - Biochemistry 2020Quote: The selected LDKA-like peptides were synthesized using standard Fmoc chemistry and purified to 98% purity using reverse phase HPLC by GenScript, Inc (Piscataway ...
-
bioRxiv - Microbiology 2022Quote: ... The N-terminal domain (Delta-like) of the SARS-CoV-2 Delta-Omicron recombinant spike was chemically synthesized as a short fragment (Genscript) and fused by overlapping PCR with the RBD and C-terminal parts of the BA.1 spike ...
-
bioRxiv - Biochemistry 2024Quote: ... Purified EGF-like domain of NRG1ý or BTC was incubated with anti-DYKDDDDK G1 affinity resin (Genscript, short anti-Flag) for 1 hour at 4 °C and serially washed 3x with Buffer A (50 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Microbiology 2020Quote: ... class C-like β-lactamase protein (gi|919167542) and the Elizabethkingia GOB-13 (AY647250) were synthesized by GenScript (Piscataway, NJ, USA) and optimized for protein expression in Escherichia coli in the pET24a(+ ...
-
bioRxiv - Biophysics 2023Quote: ... and 10 μM rat 26RFa (GenScript) were added into the cell lysis and incubated at room temperature (RT ...
-
bioRxiv - Biochemistry 2021Quote: ... Fully synthetic marmoset insulin tryptic peptide (MITP) was purchased from Genscript (>98% purity) (Piscataway ...
-
bioRxiv - Biophysics 2020Quote: ... SARS CoV-2 papain-like protease (PLpro) gene (ORF 1ab 1564 to 1876) from strain BetaCoV/Wuhan/WIV04/2019 was ordered from GenScript (Piscataway, NJ) in the pET28b(+ ...
-
bioRxiv - Molecular Biology 2023Quote: ... Equal amounts of GST-G12-like and His-AaCPR100A sonicated lysates were mixed with high-affinity GST resin (GenScript, Piscataway, NJ, USA), and then eluted ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-sera obtained from immunized rats (Genscript).
-
bioRxiv - Biochemistry 2020Quote: ... and Gl2-like (GRMZM2G315767; Zm00001d024317) ORFs were codon-optimized for expression in Arabidopsis with GeneOptimizer (GeneArt, LifeTechnologies) and OptimumGeneTM (GenScript, Piscataway, NJ; www.genscript.com), respectively ...
-
bioRxiv - Neuroscience 2021Quote: cDNA encoding rat NBCe2 was purchased from GenScript and subcloned into the oocyte expression vector pXOOM ...
-
bioRxiv - Cell Biology 2022Quote: ... rat-anti-Sasshort (1:50, GenScript USA Inc.); mAb Cq4 against crumbs (1:100 ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit anti-rat kangaroo-Kid (3μg/ml, Genscript). The anti-rat kangaroo Kid was raised against the full Kid protein translated from the coding sequence obtained from the PtK transcriptome (Udy et al. ...
-
bioRxiv - Cancer Biology 2019Quote: Custom rat anti-KRAS4A antibody was developed by Genscript using the peptide sequence CEIRQYRLKKISKEEK as antigen for immunization..
-
bioRxiv - Bioengineering 2022Quote: ... The rat Arc 5’ UTR sequence was synthesized by Genscript. Molecular cloning techniques (PCR amplification ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting the c-MYC stop codon and 3’ end of its 3’UTR (300pmol, supplementary table 3) and pUC57 or pUC57-Mini donor plasmid (1000ng; GenScript Gene Sythesis) containing recombinant sequences for dGFP ...
-
bioRxiv - Neuroscience 2020Quote: ... Rat granulocyte colony stimulating factor (G-CSF) was purchased from GenScript Corp (Piscataway NJ ...
-
bioRxiv - Immunology 2022Quote: Immunization of Wistar rats for hybridoma generation was conducted by GenScript USA ...
-
bioRxiv - Bioengineering 2019Quote: ... (3) the 3’UTR region of the corresponding U6 snRNA was gene synthesized by GenScript; (4 ...
-
bioRxiv - Cell Biology 2019Quote: ... Rat polyclonal antibodies against full-length recombinant GST-tagged PfAlba3 were from GenScript Corporation ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Human C-type natriuretic peptide (CNP) and rat atrial natriuretic peptide (ANP) were from GenScript Corp ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...
-
bioRxiv - Molecular Biology 2023Quote: ... radiodurans (Supplementary Table 3) were synthesized by GenScript, along mini-Tn elements containing a chloramphenicol resistance gene ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 U/mL erythropoietin (all from Genscript). Cultures were allowed to continue for an additional 2 weeks and then imaged and scored again ...
-
bioRxiv - Cancer Biology 2021Quote: CerS5 and CerS6 knock-out clones of DLD-1 cells were generated using the LentiCRISPR v2.0 system with guide RNAs (gRNAs; CerS5; 5’-GCTTGTCCTGATTCCTCCGA-3’ and CerS6; 5’-GGCTCCCGCACAATGTCACC-3’) purchased from GenScript (Piscataway, NJ USA). DLD-1 cells were transiently transfected using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLentiCRISPR v2 plasmids that contained predesigned guide RNA targeting mouse ATP2C1 (KO, 5′-TGATGCCGTCAGTATCACTG-3′) and scrambled control guide RNA (SCRM, 5’- AAACCAAAGAGCCGAAGAAC-3’) were obtained from GenScript (Piscataway, NJ). These plasmids were then transfected into Min6 using Lipofcetamin 3000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’-AATTCGGTCATGCCAGCGTA-3’) to target the mFoxO1gene and scrambled sgRNA (Sc-sgRNA) (5’-GCGAGGTATTCGGCTCCGCG-3’) were custom made by Genscript (Piscataway, NJ).
-
bioRxiv - Biochemistry 2021Quote: ... which contained an intact 3’UTR (GenScript, Piscataway, NJ). Two concentrations of Zfp36l1 (WT and mutant ...
-
bioRxiv - Immunology 2022Quote: ... The purified protein was used to immunize Wistar rats to generate a panel of monoclonal antibodies by Genscript USA ...
-
bioRxiv - Biochemistry 2021Quote: ... coli expression (Supplementary Table 3) and synthesized in vitro (Genscript). For protein expression ...