Labshake search
Citations for GenScript :
1 - 21 of 21 citations for Pyr6 Substance P since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... anti-p-CBX8 (Ser311) generated by Genscript.
-
bioRxiv - Cell Biology 2020Quote: ... and the fragments with mutation of twenty prolines into glycines (P/G) or leucines (P/L) were synthesized by Genscript (USA) and inserted into pcDNA3 Flag-HA plasmid using BamHI and EcoRI restriction sites ...
-
bioRxiv - Biochemistry 2020Quote: ... rabbit anti-Hcp1 (P. aeruginosa) (diluted 1:5,000, Genscript) and detected with anti-rabbit horseradish peroxidase-conjugated secondary antibodies (diluted 1:5,000 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 10 µM P-factor (peptide-seq.: TYADFLRAYQSWNTFVNPDRPNL) (GenScript), DIX61 (MTNR1A ...
-
bioRxiv - Bioengineering 2019Quote: ... then supplemented with 100 ng/ml sakacin P (SppIP) (Genscript). The cultures were allowed to grow overnight ...
-
bioRxiv - Cancer Biology 2021Quote: ... The custom polyclonal p-Smurf2Thr249 antibody was generated (#J1683BA260-5) (GenScript). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... Ppl and TerY-p systems were synthesized and cloned by Genscript Corp ...
-
bioRxiv - Cancer Biology 2021Quote: ... The primary antibodies used were, anti-p-Smurf2Thr249 (#J1683BA260-5, 1:2000) (GenScript), anti-Phospho-Smad2 (Ser465/467 ...
-
bioRxiv - Microbiology 2020Quote: ... (2) the mScarlet gene (amplified from a P. falciparum codon-adjusted synthetic sequence (Genscript) (Fig ...
-
bioRxiv - Microbiology 2023Quote: Synthetic peptides of P covering the sequence N-EDDIYQLIM-C were obtained from GenScript. The peptide was dissolved in deionised water dosed with a drop of 5 M NH4OH to improve solubility ...
-
bioRxiv - Biochemistry 2023Quote: HeLa cells were lentiviral transduced with pLentiCRISPRv2 P-Rex1 guide RNA3 - AGGCATTCCTGCATCGCATC (Genscript SC1678). Forty-eight hours after transduction ...
-
bioRxiv - Cell Biology 2022Quote: ... P-factor (TYADFLRAYQSWNTFVNPDRPNL) and α-factor (WHWLQLKPGQPMY) (Custom Peptide Synthesis, 4 mg, ≥95% purity, GenScript Biotech) were dissolved in DMSO to a concentration of 10 mM ...
-
bioRxiv - Biochemistry 2020Quote: ... All P-Rex2 and PTEN mutations were synthesised and sequence-verified in the same vectors by Genscript. Rac1 (G12V ...
-
bioRxiv - Bioengineering 2023Quote: ... plantarum NCIMB8826 strain harboring helper plasmid pLH01 was induced with 100 ng/ml Sakain P peptide (GenScript) for RecE/T expression and was subsequently prepared as competent cells ...
-
bioRxiv - Microbiology 2021Quote: The CAN97-83 HMPV N0-P construct with a 6X C-terminal His6-tag was synthesized by GenScript in the pET-29b(+ ...
-
bioRxiv - Microbiology 2022Quote: ... plantarum strain harboring helper plasmid pLH01 was induced with 100 ng/ml Sakain P peptide (GenScript, Piscataway, NJ) to express RecE/T and made electrocompetent ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... simulansOr67a.P we generated a T2A-Gal4 targeting vector flanked by homology arms (1-1.1 kb) via gene synthesis (GenScript Biotech) as described [70].
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2024Quote: ... An elongation factor EF-P (GeneFrontier Corporation) and synthesized SKIK peptide dissolved in nuclease-free water (94.6% purity, GenScript, Tokyo) was added to achieve a final concentration of 1 µM and 100 µM ...
-
bioRxiv - Immunology 2020Quote: ... and cultured in the presence of Phl p 6 or the mutants (20µg/mL) or individual peptides of a 15mer library (GenScript, NJ, USA) with an offset of 3 amino acids (10µg/mL ...
-
bioRxiv - Bioengineering 2023Quote: ... The PNIPAM conjugation reaction was altered to modify either 0.5 or 1 arm of the PEG-vinyl sulfone while the unreacted 7 arms were further reacted with excess P peptide (EYPPYPPPPYPSGC, 1563 g/mol; GenScript Corp.). Conjugation reactions were confirmed via 1H nuclear magnetic resonance ...