Labshake search
Citations for GenScript :
1 - 41 of 41 citations for PD L2 Cynomolgus HEK 293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... recombinant human ACE2-IgG-Fc fragments (r-hACE2-Fc) (GenScript, Z03516) were firstly incubated with the Protein-G agarose (Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... ACE-2 –Fc (GenScript Z033484) was diluted at 1.2µg/ml in HBS P+ (Cytiva ...
-
bioRxiv - Immunology 2020Quote: Recombinant human ACE2-Fc (Genscript) at concentration of 2 μg/ml in phosphate buffer saline (PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK 293T cells were transfected with pLentiCRISPR V2 vectors (GenScript) expressing S ...
-
bioRxiv - Biochemistry 2021Quote: RBD inhibition assay: HEK-293T cells stably expressing hACE2 (GenScript M00770) were seeded into a 24-well plate at an initial density of 6 x 104 cells per well ...
-
bioRxiv - Microbiology 2020Quote: ... the recombinant protein ACE2-Fc (Genscript) at 5 μg/mL buffered in PBST (PBS with 0.02% Tween 20 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Biochemistry 2021Quote: ... HEK-293T stable transfected with ACE2 (GenScript M00770, 8000 cells per assay), Caco2 cells (40,000 cells per assay) ...
-
bioRxiv - Bioengineering 2021Quote: ... 843 RUs of SARS-CoV-2 RBD/SD1 fused to human Fc (RBD/SD1-Fc) and 972 RUs of EGFR (Genscript, Piscataway ...
-
bioRxiv - Immunology 2020Quote: ... hACE2-Fc was synthesized and cloned by GenScript with a BM40 signal peptide ...
-
bioRxiv - Microbiology 2021Quote: ... hACE2-Fc was synthesized and cloned by GenScript with a BM40 signal peptide ...
-
bioRxiv - Microbiology 2020Quote: ... the recombinant protein of the extracellular domain of human ACE2 (aa 1-740) fused to Fc (ACE2-Fc, Genscript, Nanjing, China) was coated on 96-well microtiter plate (50 ng/well ...
-
bioRxiv - Immunology 2023Quote: ... a biotinylated rat polyclonal antibody against human Fc was used as a capture antibody and anti-human IgG Fc-HRP (GenScript Cat# A01854-200) as a detection antibody ...
-
bioRxiv - Cancer Biology 2020Quote: ... the PD-L1-lnc shRNA vectors were synthesized and then cloned into pLKO.1 vector (GenScript, China). The siRNA target sequences were listed in table S3 ...
-
bioRxiv - Immunology 2022Quote: ... ACE2 fused to human IgG1 Fc domain was gene synthesized (Genscript) and cloned into pCEP4 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full-length cDNA of PD-L1-lnc was synthesized and cloned into pcDNA3.1-P2A-eGFP vector (GenScript, China). To suppress PD-L1-lnc ...
-
bioRxiv - Biochemistry 2021Quote: ... Primary antibodies (anti-FLAG M2; Sigma and chimeric ACE2-Fc (Genscript; Z03484) were diluted in PBS-BSA to 1 μg mL−1 and added to each imaging dish ...
-
bioRxiv - Immunology 2020Quote: ... Two commercially available ACE2-Fc proteins obtained from Genscript (Cat.No. Z03484-1) and Acrobiosystems (Cat.No ...
-
bioRxiv - Immunology 2023Quote: Antibody binding was also assayed by flow cytometry using CHO-K1 and CHO-K1 Fut8 KO cells transfected with a human PD-1 plasmid (GenScript) by lipofectamine (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Horseradish peroxidase (HRP) labeled-mouse anti-human IgG-Fc specific (GenScript No. A01854) diluted 1:10,000 in PBST was added (100μl/well ...
-
bioRxiv - Immunology 2023Quote: DNA encoding for residues 24-167 of the extracellular portion of human PD-1 (UniProt Q15116) with a C-terminus histidine tag or corresponding PD-1 N58Q mutant were cloned into pcDNA3.4 by GenScript (Piscataway, NJ). Expi293 cells were transiently transfected with plasmid DNA mixed with PEI (Polysciences ...
-
bioRxiv - Biophysics 2020Quote: ACE2-Fc expression vector was generated by subcloning a gene-synthesized cDNA template (GenScript) encoding soluble human ACE2 (amino acid residue 1-738 ...
-
bioRxiv - Bioengineering 2021Quote: Codon-optimized genes for bivalent VHH-Fcs were synthesized and cloned into pTT5 (GenScript; Piscataway ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: The sequences containing 7F9-Fc cDNA were custom synthesized and ligated into pUC57 (GenScript). Plasmids containing 7F9-Fc were transformed into Invitrogen Top10F competent cells (Thermo #C303003 ...
-
bioRxiv - Immunology 2020Quote: ACE2-Fc expression vector was generated by subcloning a gene-synthesized cDNA template (GenScript) encoding soluble human ACE2 (amino acid residue 1-738 ...
-
bioRxiv - Microbiology 2021Quote: ... ECD or those with desired ACE2 mutations were fused to the codon-optimized synthetic IgG1 Fc (GenScript) in which GASDALIE or LALA mutations were incorporated ...
-
bioRxiv - Immunology 2020Quote: ... synthesized in vitro and subcloned into a pcDNA3.4 vector containing the human IgG1 Fc region by a commercial partner (Genscript). Transfection grade plasmids were purified by maxiprep and transfected into a 293-6E expression system ...
-
bioRxiv - Immunology 2021Quote: ... synthesized in vitro and subcloned into a pcDNA3.4 vector containing the human IgG1 or IgA1 Fc region by a commercial partner (Genscript). Transfection grade plasmids were purified by maxiprep and transfected into a 293-6E expression system ...
-
bioRxiv - Immunology 2022Quote: ... nanobodies containing human IgG1 Fc in the culture supernatant were captured by AmMag Protein A Magnetic Beads (Genscript L00695) and eluted by Glycine pH 3.0 ...
-
bioRxiv - Microbiology 2022Quote: ... hACE2-Fc was produced in Expi293F cells and purified from the clarified culture supernatant using Protein G-Agarose (Genscript) followed by SEC on a Superdex 200 16/600 column linked to an AKTApure instrument (Cytiva) ...
-
bioRxiv - Molecular Biology 2022Quote: IgGFc: Human IgG Fc Sequence (Supplementary Material Figure S1) was codon optimized for HEK293 expression and synthesized from Genscript USA in pUC57 vector ...
-
bioRxiv - Immunology 2022Quote: ... and subcloned into an expression vector containing the human IgG1 or IgA1 Fc region by a commercial partner (Genscript). Transfection grade plasmids were purified by maxiprep and transfected into CHO cells ...
-
bioRxiv - Immunology 2022Quote: ... fused at the C-terminus to the Fc region of human IgG1 and cloned into pcDNA3.1(+) vector by Genscript.
-
bioRxiv - Immunology 2024Quote: Cognate VH and VL antibody sequences of interest were synthesized and cloned into a customized pcDNA 3.4 vector containing a human IgG1 Fc region by GenScript Biotech ...
-
bioRxiv - Microbiology 2020Quote: ... samples were added in duplicate (100μl/well) followed by the addition of the anti-human IgG-Fc-HRP (GenScript No. A01854) conjugate (diluted 1:10,000 ...
-
bioRxiv - Immunology 2021Quote: A 96-well plate was coated overnight at 4ºC with 100 µL of a recombinant human ACE-2 fused to a Fc fragment (GenScript Laboratories, USA) at 1 µg/mL in carbonate buffer (pH 9.6) ...
-
bioRxiv - Immunology 2023Quote: ... Raw values were normalized to a synthetic standard on each plate (VHH72-Fc by NRC for spike/RBD or an anti-N IgG from Genscript, #A02039). The relative ratios were further converted to BAU/mL using the WHO International Standard 20/136 as a calibrant (33 ...
-
bioRxiv - Biochemistry 2022Quote: ... from various snake species were selected from NCBI databases and cloned into a mammalian expression vector containing a C-terminal Avi™ tag followed by a WELQut™ cleavage tag and a rabbit Fc tag by Genscript. Plasmid DNA was prepped and co-transfected with a plasmid expressing the BirA enzyme for in vivo biotinylation into Expi293 cells using FectoPRO® (Polyplus Transfection) ...
-
bioRxiv - Immunology 2023Quote: ... was used as a capture antibody and rabbit polyclonal antibody raised against IL-7Rγ peptide agonist followed by a mouse anti-rabbit IgG Fc HRP (Genscript Cat# A01856-200) as a detection antibody ...
-
bioRxiv - Microbiology 2022Quote: ... Immunizations were done on eight-to twelve-week-old H2L2 mice interperitoneally with 50-100 μg of a recombinant SARS-CoV2 Spike RBD319-591-Fc fusion protein generated from sequence from the original Wuhan seafood market pneumonia virus isolate (GenBank Accession# MN908947) and cloned in-frame into pcDNA vectors containing human IgG1 and mouse IgG2a Fc tags (GenScript USA Inc., Piscataway, NJ). Each mouse received a prime followed by 2 boosts ...