Labshake search
Citations for GenScript :
1 - 50 of 313 citations for PD L1 Human HEK293 mFc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.5 µg RBD-mFc (GenScript)/ml PBS-T was added to all wells and incubated for 2 hours ...
-
bioRxiv - Genomics 2021Quote: ... human Hek293 DNA was purchased from Genscript. S ...
-
bioRxiv - Cancer Biology 2020Quote: ... the PD-L1-lnc shRNA vectors were synthesized and then cloned into pLKO.1 vector (GenScript, China). The siRNA target sequences were listed in table S3 ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full-length cDNA of PD-L1-lnc was synthesized and cloned into pcDNA3.1-P2A-eGFP vector (GenScript, China). To suppress PD-L1-lnc ...
-
bioRxiv - Immunology 2022Quote: ... using eBlot L1 (GenScript). Membranes were blocked and stained with primary antibody overnight in 5% nonfat dry milk in 0.1% PBST ...
-
bioRxiv - Biophysics 2020Quote: ... The codon optimized genes were synthesized for expression in human epithelium kidney cells (HEK293) (GenScript, Piscataway, NJ, USA), but were also found to prone to recombination upon insertion into pCDNA3.1 ...
-
bioRxiv - Molecular Biology 2022Quote: MFcS2: Modified human ACE2 (Sequence-Supplementary Material S1) was codon optimized for HEK293 expression and synthesized from Genscript USA in pUC57 vector ...
-
bioRxiv - Neuroscience 2022Quote: ... Proteins were transferred to PVDF membranes with the eBlot® L1 system using eBlot® L1 Transfer Stack supports (Genscript) and the resulting membranes were washed three times with TBS-T (Tris-buffered saline containing 0.1 % Tween® 20 (Merk)) ...
-
bioRxiv - Molecular Biology 2022Quote: IgGFc: Human IgG Fc Sequence (Supplementary Material Figure S1) was codon optimized for HEK293 expression and synthesized from Genscript USA in pUC57 vector ...
-
bioRxiv - Cell Biology 2021Quote: ... Gels were transferred through eBlot L1 (GenScript L00686) onto nitrocellulose membranes (BioRad 1620112) ...
-
bioRxiv - Microbiology 2021Quote: ... eBlot L1 –Fast Wet Protein Transfer System (GenScript) was used for blotting and proteins were stained using the following antibodies ...
-
bioRxiv - Immunology 2023Quote: Antibody binding was also assayed by flow cytometry using CHO-K1 and CHO-K1 Fut8 KO cells transfected with a human PD-1 plasmid (GenScript) by lipofectamine (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2021Quote: ... nonreducing gels and transferred using eBlot L1 Transfer system (GenScript). Blots were blocked in 5% Bovine Serum Albumin (BSA ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the eBlot™ L1 Fast Wet Transfer System (GenScript) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... using an eBlot™ L1 wet transfer (GenScript Biotech, China). Membranes were blocked and incubated with primary antibodies and secondary antibodies using eZwest Lite Automated Western Device (GenScript Biotech ...
-
bioRxiv - Zoology 2020Quote: ... Gels were stained with Coomassie brilliant blue using eStainTM L1 (Genscript).
-
bioRxiv - Cell Biology 2022Quote: ... Protein was transferred to a PVDF membrane using eBlot L1 (Genscript). Blocking was performed with 5% milk in PBST (PBS + 0.1% TritonX-100 ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by staining using the eStain L1 Protein Staining System (GenScript). PAGE-MASTER Protein Standard Plus (GenScript ...
-
bioRxiv - Plant Biology 2021Quote: ... using a highly efficient wet protein transfer system (eBlot L1; GenScript, Nanjing, China). The membranes were blocked for 2 h at room temperature in TBST solution (2 mM This-HCl ...
-
bioRxiv - Plant Biology 2023Quote: ... and transferred to PVDF membrane using an eBlot™ L1 transfer system (GenScript). The target proteins were probed with corresponding antibodies.
-
bioRxiv - Plant Biology 2022Quote: ... Sample in the gel were transferred to PVDF membrane using eBlot™ L1 (GenScript Corporation). Anti-HA (1:5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... whereas all other gels were stained using the eStain™ L1 protein staining system (GenScript). Precision Plus Protein™ standards (Bio-Rad Laboratories ...
-
Sterilizing immunity against SARS-CoV-2 in hamsters conferred by a novel recombinant subunit vaccinebioRxiv - Microbiology 2020Quote: ... Coomassie brilliant blue staining for SDS-PAGE were performed using eStain L1 Protein Staining machine (Genscript). Gels for western blot were transferred onto the nitrocellulose membrane and reacted with COVID-19-convalescent serum (1:500 diluted) ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA from the HEK293 cell line was purchased from GenScript (https://www.genscript.com).xs
-
bioRxiv - Biochemistry 2023Quote: ... or proteins were transferred to PVDF membranes using an eBlot L1 protein transfer system (GenScript, Piscataway, NJ) and used for immunoblotting.
-
bioRxiv - Cancer Biology 2023Quote: The inducible L1 reporter plasmid used to generate HeLa tet-L1/GLucAI cells (pBH001) was generated through a series of successive PCR-based cloning steps performed by GenScript. pBH001 is comprised of a tetracycline-regulated bidirectional promoter for inducible expression of both firefly luciferase (a fragment cloned from the pTRE3G-BI-Luc control plasmid (Takara Bio) ...
-
bioRxiv - Cancer Biology 2023Quote: Capture antibodies: affinity purified rabbit anti-L1 (anti-ORF1p or anti-ORF2p (RT fragment)) polyclonal antibodies were ordered from GenScript (Custom Polyclonal Antibody Production Service) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Gels were transferred to a PVDF membrane using the eBlot™ L1 Fast Wet Transfer System (GenScript, Piscataway, NJ, USA). Membranes were blocked in 5% non-fat dry milk in 1× TBST rocking for 1hr at room temperature ...
-
LRP1 mediates leptin transport by coupling with the short-form leptin receptor in the choroid plexusbioRxiv - Neuroscience 2023Quote: ... Neuro-2a cells or HEK293 cells were transiently transfected with pcDNA3.1(+)-C-DYK-mLRP1 (mouse LRP1 CDS; NM_008512.2, Genscript) and pcDNA3.1(+)-N-HA-mLepR (mouse LepR isoform A CDS ...
-
bioRxiv - Biochemistry 2021Quote: ... Human EPCR cDNA (Genscript) was PCR amplified and cloned in frame with a GP64 signal peptide in a pAcGP67A transfer vector ...
-
bioRxiv - Immunology 2020Quote: ... and the S1-Receptor Binding Domain (S1-RBD; Cat. No Z03483; expressed in HEK293 cells) were purchased from by GenScript. The S1-N-terminal domain (S1-NTD ...
-
bioRxiv - Molecular Biology 2020Quote: ... The donor sequence with 700 bp homology arms on each side of the insert site was designed based on the HEK293 reference genome52 and synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Biochemistry 2024Quote: ... fused to consecutive C-terminal HA (hemagglutinin)- and FLAG-tags and cloned into pCDNA-3.1 plasmid for expression in HEK293 cells by the CMV (cytomegalovirus) promoter (GenScript Biotech). Mutant variants were generated by site directed mutagenesis (GenScript Biotech).
-
bioRxiv - Biochemistry 2021Quote: The cDNAs encoding for human ASGR1 and human ASGR2 were obtained from GenScript (NJ). Human ASGR1 and its mutants (Q240A/W244A and Q240A/W244A/E253A ...
-
bioRxiv - Cell Biology 2024Quote: pcDNA3.1 vectors expressing human caspase-4 and human IL-18 were purchased from Genscript. Mutagenesis primers were designed using Aligent Quik change primer design ...
-
bioRxiv - Biochemistry 2024Quote: The full-length cDNAs for human SIDT1 and human SIDT2 were synthesized by Genscript Company (SIDT1 ...
-
bioRxiv - Cancer Biology 2023Quote: MSH2-MSH6: Human MSH2 and human MSH6-GFP were synthesized into pFASTBac1 constructs (GenScript) and were co-infected into Sf9 insect cells for expression ...
-
bioRxiv - Immunology 2023Quote: DNA encoding for residues 24-167 of the extracellular portion of human PD-1 (UniProt Q15116) with a C-terminus histidine tag or corresponding PD-1 N58Q mutant were cloned into pcDNA3.4 by GenScript (Piscataway, NJ). Expi293 cells were transiently transfected with plasmid DNA mixed with PEI (Polysciences ...
-
bioRxiv - Immunology 2020Quote: Recombinant human ACE2-Fc (Genscript) at concentration of 2 μg/ml in phosphate buffer saline (PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... human IL11 (hIL11, Z03108, Genscript), mouse IL11 (mIL11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... human AMPKγ3 (GenScript, NJ, USA) and mouse AMPKγ3 (Yenzym ...
-
bioRxiv - Cell Biology 2023Quote: The pcDNA3.1-NR2A (catalog #: OHu24642D, NM_000833, human) and the pcDNA3.1-NR1 (catalog #: OHu22255D, NM_007327, human) plasmids were purchased from GenScript. The pcDNA3.1-BiP plasmid was provided by Dr ...
-
bioRxiv - Cell Biology 2021Quote: Codon optimized human SHIP164 generated by Genscript was amplified using PCR from the pUC57 plasmid and ligated into various mammalian and bacterial expression plasmids ...
-
bioRxiv - Neuroscience 2022Quote: Human Stathmin expression clones were from Genscript (STMN1-OHu14092D ...
-
bioRxiv - Biophysics 2022Quote: Isoform 1 of human SERINC2 (GenScript-OHu23082D) was cloned into pFastBacI with the TEV and STREP cleavage and affinity tags upstream of the gene encoding hSERINC2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... residues A27-T157), human FZD7 CRD (UniProt: O75084, residues Q33-G170), human FZD8 CRD (UniProt: Q9H461, residues A28-T158) were synthesized (Genscript). Human LRP6 P1E1P2E2 (UniProt ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-human IgG peroxidase conjugated (A00166, GenScript, USA) or anti-mouse IgG peroxidase conjugated (A4416 ...
-
bioRxiv - Cancer Biology 2022Quote: ... murine and human CD20 cDNA expression constructs (GenScript) were transiently transfected into 293T cells using lipofectamine (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2022Quote: The H3F3A and H3F3B human cDNA sequences (GenScript) were cloned by using ClaI and EcoRI restriction enzymes into the pSNAPm plasmid (New England Biolabs) ...